Journal of Cancer Research and Therapeutics

ORIGINAL ARTICLE
Year
: 2018  |  Volume : 14  |  Issue : 5  |  Page : 1023--1028

Synergistic effect of temozolomide and thymoquinone on human glioblastoma multiforme cell line (U87MG)


Mona Pazhouhi1, Reyhaneh Sariri1, Mohammad Rasoul Khazaei2, Mohammad Taher Moradi2, Mozafar Khazaei2,  
1 Department of Biology, Faculty of Sciences, University of Guilan, Rasht, Iran
2 Fertility and Infertility Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran

Correspondence Address:
Mozafar Khazaei
Fertility and Infertility Research Center, Kermanshah University of Medical Sciences, Kermanshah
Iran

Abstract

Aims: Temozolomide (TMZ) is an alkylating agent used for glioblastoma multiforme (GBM) treatment. Nevertheless, resistance to TMZ is a major obstacle to successful treatment of this cancer. The aim of the present study was to investigate the effects of TMZ and thymoquinone (TQ) on U87MG cell line. Materials and Methods: The effect of TMZ and/or TQ on viability and invasion potential of U87MG cells was evaluated using various techniques including 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, lactate dehydrogenase activity, cell invasion, migration, and adhesion assays. Enzyme-linked immunosorbent assay and polymerase chain reaction were used to study the expression and secretion of matrix metalloproteinases (MMPs). Results: Combination of TMZ and TQ had a synergistic cytotoxic effect on U87MG cells. TMZ and/or TQ significantly reduced the potential of U87MG cells invasion. In addition, after treating with TMZ and/or TQ, there was a decrease in the levels of matrix matrix metalloproteinase 2 nad 9 (MMP 2 and 9) expression and secretion in U87MG cells. Conclusions: The combination of TMZ and TQ may emerge as a promising strategy for the successful treatment of GBM.



How to cite this article:
Pazhouhi M, Sariri R, Khazaei MR, Moradi MT, Khazaei M. Synergistic effect of temozolomide and thymoquinone on human glioblastoma multiforme cell line (U87MG).J Can Res Ther 2018;14:1023-1028


How to cite this URL:
Pazhouhi M, Sariri R, Khazaei MR, Moradi MT, Khazaei M. Synergistic effect of temozolomide and thymoquinone on human glioblastoma multiforme cell line (U87MG). J Can Res Ther [serial online] 2018 [cited 2022 Oct 5 ];14:1023-1028
Available from: https://www.cancerjournal.net/text.asp?2018/14/5/1023/187241


Full Text



 Introduction



Glioblastoma multiforme (GBM) is the most aggressive primary brain tumor and develops from star-shaped glial cells, called astrocytes. It is among the most lethal types of human cancers, and the median survival time of patients is about 14 months. Currently, the standard treatments applied for GBM patients consist of surgical resection and radiotherapy with concomitant chemotherapy with a DNA alkylating agent.[1],[2]

Temozolomide (TMZ) (C6H6N6O2) is an oral alkylating agent, approved by the Food and Drug Administration for the treatment of GBM.[3] It acts by methylation of DNA at specific sites on guanine and adenine. These methylation causes DNA damage during cell replication, induces cell cycle arrest, mitotic catastrophe,[4] apoptosis,[5] and/or autophagy.[6] However, GBM is still associated with a poor prognosis, mainly because of the TMZ resistance.[7] Therefore, enhancement of the anticancer effect of TMZ for brain tumors treatment is necessary. It seems that combination therapy using multiple anticancer agents with different mechanism of actions and/or targets is a suitable solution to overcome the resistance.

Thymoquinone (TQ) (C10H12O2) is the main bioactive component of the volatile oil of the black seed (Nigella sativa, Ranunculaceae family) and has been shown to own antioxidant, anti-inflammatory, and antineoplastic properties.[8] Studies have illustrated that TQ has the cytotoxic effects on several types of cancer cell lines including breast adenocarcinoma, leukemia, lung cancer, colorectal carcinoma, pancreatic cancer, osteosarcoma, and prostate cancer,[8] whereas it is minimally toxic to normal cells.[9] Furthermore, its antineoplastic potential against several multidrug resistant tumor cell lines has been demonstrated.[9] In GBM, TQ has an antiproliferative effect through inhibition of autophagy, induction of DNA damage and apoptosis [10],[11] and also reduces migration and invasion ability of human GBM cells.[12]

Previous studies have shown that combination of TMZ with some natural agents enhances its effectiveness on glioblastoma cells.[13],[14],[15],[16],[17],[18] The aim of the present study was to investigate the anticancer effects of TMZ and/or TQ on U87MG glioblastoma cancer cell line.

 Materials and Methods



Cell line and reagents

The human glioblastoma cell line (U87MG) was obtained from the National Cell Bank of Iran. TMZ, TQ, Dulbecco's modified Eagle medium/Ham's F-12 nutrient mixture (DMEM/F-12) medium, fetal bovine serum (FBS), trypsin, and dimethyl sulfoxide were all purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA). All experiments were performed in triplicate and repeated independently at least three times.

Cell culture and treatments

U87MG cell line was cultured in DMEM/F-12, supplemented with 10% FBS, without antibiotics, and maintained in a humidified 5% CO2 incubator at 37°C. To dose response study, cells were incubated with 10, 20, 50, 100, 150, and 200 μM TMZ and TQ for 24, 48, and 72 h. Then, for analysis of median effect, according to IC50 values of TMZ and TQ, fixed ratio drug combinations were done.[19] For other tests, concentration of 100 μM TMZ and/or 50 μM TQ (about their IC50s) was chosen.

Cell viability assay

The effects of TMZ and TQ on cell viability were quantified by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assay. U87MG cells (15 × 103) were cultured in 96 well plates, treated with different concentrations of TMZ and TQ, and incubated for 24, 48, and 72 h. Then, the MTT assay was performed as previously described.[20]

Median effect analysis

To quantitatively assess the nature of TMZ and TQ interaction (synergistic, additive, or antagonistic), the method proposed by Chou,[19] was used. The combination of TMZ and TQ in fixed concentration ratio (1.87:1) based on their corresponding IC50 values (90.63 and 48.50 μM for TMZ and TQ, respectively) in 2-fold serial dilutions above and below the IC50 value of each agent was done,[19] and then the MTT assay was performed again. The combination index (CI) and dose reduction index (DRI) values were calculated using CompuSyn software (ComboSyn, Inc., Paramus, NJ, USA).

The CI values were interpreted as additive (CI = 1), synergistic (CI <1), and antagonistic (CI >1). DRI value represents the degree to which the concentration of a compound can be reduced when used in combination with another compound to maintain an equivalent effect, and Fa is the fraction of cell death ranging from 0 (no cell killing) to 1 (100% of cell killing).

Classical isobolograms were also constructed by plotting drugs concentrations (alone and in combination) that inhibit 50%, 75%, and 90% viability. In this plot if the combination data points fall on the hypotenuse, lower left, or upper right an additive, synergism, or antagonism effect is suggested, respectively.

Cytotoxicity assay

To quantify the TMZ and/or TQ cytotoxicity on U87MG cell line, lactate dehydrogenase (LDH) activity in culture medium was measured using colorimetric LDH assay kit (Abcam, Cambridge, MA, USA). Briefly, U87MG cells (7 × 104) were cultured in 4well plates and treated with 1.5 ml medium containing TMZ and/or TQ. After 72 h incubation period, the supernatant was collected and centrifuged at 250 ×g for 10 min and LDH activity was measured in accordance with manufacturer's instructions.

Migration assay

An in vitro scratch assay was performed to examine the effect of TMZ and/or TQ on the migratory ability of GBM cells. U87MG cells (7 × 104) were cultured in 4 well plates and allowed to form confluent monolayer. Then, the monolayers were scratched using a sterile pipette tip, and debris was removed by washing with phosphate-buffered saline (PBS). Medium containing TMZ and/or TQ was added, and plates were incubated for 72 h and then photographed using an inverted microscope. Finally, images were analyzed by means of TScratch software, version 1.0 (MathWorks Inc., MA, USA).[21]

Invasion assay

Invasion assay was performed to determine the effect of TMZ and/or TQ on the invasion potential of GBM cells using the CytoSelect 24-well cell invasion assay kit (Cell Biolab, San Diego, CA, USA) according to the manufacturer's instructions. Briefly, 7 × 105 cells, pretreated with TMZ and/or TQ for 72 h, were plated in serum-free medium on upper chambers, whereas medium supplemented with 10% FBS were placed in the lower chambers. After 6 h of incubation, the top of the membrane was rubbed with a cotton swab to remove all the cells not capable of invading, and the cells passing through the membrane were stained and photographed under inverted microscope. After extraction of cells, absorbance of each sample was read in 560 nm.[22]

Adhesion assay

To determine the effect of TMZ and/or TQ on the adhesive properties of GBM cells, in vitro adhesion assay was performed. GBM cells (7 × 104), preincubated with TMZ and/or TQ for 72 h at 37°C, were cultured in 4 well plates coated with gelatin for 20 min at 37°C. Unattached cells were removed by washing with PBS. Attached cells were fixed in 4% paraformaldehyde for 20 min, stained with 0.5% crystal violet solution for 20 min. Then, to quantify the cells attachment, crystal violet was dissolved with 10% acetic acid and absorbance was measured at 560 nm.[23]

An enzyme-linked immunosorbent assay

U87MG cells were treated with TMZ and/or TQ for 6 h. Concentrations of matrix metalloproteinase (MMP) 2 and 9 in the cell culture supernatants were quantified using Human MMP-9 and 2 enzyme-linked immunosorbent assay (ELISA) kits (RayBiotech, Norcross, GA, USA) according to the manufacturer's instructions.

Real-time polymerase chain reaction

The effect of TMZ and/or TQ on the expression level of MMP-2 and MMP-9 genes was analyzed by real-time polymerase chain reaction (PCR). Total RNA from GBM cells, treated with TMZ and/or TQ for 72 h, was extracted by total RNA isolation kit (DENAzist, Tehran, Iran) and complementary DNA (cDNA) synthesis was carried out using cDNA synthesis kit (Vivantis Technologies, Selangor DE, Malaysia). Real-time PCR was performed using SYBR Premix Ex Taq Technology (Takara Bio Inc., Shiga, Japan) on the Applied Biosystems StepOne Real-Time PCR System. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was served as an internal control and the fold change in relative expression of each target mRNA was calculated on the basis of comparative Ct (2−ΔΔct) method. The primer sequences were as follows: Forward CTTCCAAGTCTGGAGCGATGT, reverse TACCGTCAAAGGGGTATCCAT for MMP-2, forward GGGACGCAGACATCGTCATC, reverse TCGTCATCGTCGAAATGGGC for MMP-9, and forward CAATGACCCCTTCATTGACC, reverse TTCACACCCATGACGAACAT for GAPDH.

Statistical analysis

All data are presented as mean ± standard deviation of three independent experiments. Statistical evaluation was performed using one-way analysis of variance with SPSS version 16.0 (SPSS Inc., Chicago, IL, USA) software, and differences were considered to be statistically significant when P < 0.05.

 Results



Temozolomide and thymoquinone treatment

[Figure 1]a and b shows the effects of TMZ and TQ on the U87MG cell viability after 24, 48, and 72 h treatment. The results indicate that TMZ and TQ have a significant cytotoxic effect on U87MG cells. This effect was dose- and time-dependent. The IC50 values for TMZ and TQ were listed in [Table 1].{Figure 1}{Table 1}

U87MG cells were treated with TMZ and TQ in combination for 72 h. Reduction in the cell viability by TMZ and TQ combination was greater than either TMZ or TQ alone [Figure 2]a. In addition, CI plot [Figure 2]b, DRI plot [Figure 2]c, and the isobologram [Figure 2]d were also presented. The results showed that the CI values in all combinations were smaller than 1, implying a synergistic effect in all combination tests. The DRI values for both TMZ and TQ were >1 indicating a dose reduction for a given therapeutic effect in both of them.{Figure 2}

Cytotoxicity assay

Measurement of LDH activity in the cell culture medium revealed that TMZ and/or TQ significantly increased LDH release after 72 h incubation. Combination of TMZ and TQ increased medium LDH activity (~56%) greater than either TMZ (~19%) or TQ (~23%) alone [Figure 3]a. Therefore, cell death accompanied by plasma membrane damage in combination treatment was greater.{Figure 3}

Migration, invasion, and adhesion assay

After 72 h treatment, TMZ (100 μM) decreased the GBM cell migration up to 8% and TQ (50 μM) decreased it up to 60% when compared to control. However, administration of TQ in combination with TMZ reduced the percentage of cell migration by approximately 77% [Figure 3]b. TMZ and TQ markedly suppressed the invasion of GBM cells about 18% and 23%, respectively. Administration of both TQ and TMZ simultaneously reduced the percentage of cell invasion by approximately 43% [Figure 3]c. Furthermore, TMZ and TQ reduced the adhesion capacity of GBM cells to the gelatin layer compared with the untreated control cells by 12%, 55%, respectively, and combination of both decreased it up to 61% [Figure 3]d.

Enzyme-linked immunosorbent assay

The results of ELISA assay to measure the secretion of MMP-2 and MMP-9 in culture medium are shown in [Figure 4]a. TMZ and/or TQ reduced the MMP-2 secretion by 16%, 21%, and 35%, respectively, and MMP-9 secretion by about 30%, 32%, and 66%, respectively.{Figure 4}

Real-time polymerase chain reaction

Alteration in MMP-2 and MMP-9 genes expression by TMZ and TQ was also tested using real-Time PCR [Figure 4]b. Results suggested a downregulation of MMP-2 and MMP-9 genes expression after 72 h treatment with TMZ and TQ alone and in combination.

 Discussion



In this study, we reported for the first time the synergistic effect of TMZ, an approved chemotherapy agent, and TQ, a phytochemical compound, on the growth of GBM cells. Our results showed that TMZ and TQ significantly inhibit cell proliferation in a time- and dose-dependent manner. Combination treatment significantly enhanced TMZ-mediated cytotoxicity with CI values between 0.51 and 0.33, indicating synergistic effects at all combination concentrations. The mean CI of all tests is 0.39, which indicates synergistic effect of TMZ and TQ on U87MG cell line. This combination also results in a dose reduction for both TMZ and TQ and reduces the IC50s to about 1.53-fold smaller for TQ and 2.68-fold smaller for TMZ. Dose reduction of TMZ for given cytotoxicity effect is clinically very important since this reduction leads to reduced general side effects of chemotherapy.

Despite recent improvements in cancer treatment, GBM is still associated with a poor prognosis and short-term survival of the patients mainly because of drug resistance. Hence, development of new strategies for overcoming this problem is necessary. Combination therapies are the most of the current strategies against cancer because multiple drugs affect multiple targets and cell subpopulations and therefore can enhance the therapeutic effects, reduce dose and side effects, and prevent or delay the induction of drug resistance.[24]

We also showed that TMZ and TQ reduce the potential of migration, invasion, and adhesion of U87MG cells. Cell migration and invasion are the main features of malignant tumors,[25] and this is especially true in GBM which rarely metastasize to other organs, but whose infiltrative growth pattern is a hallmark of this tumor, and local recurrence is the main cause of death of this disease.[26] Thus, this invasion capability, along with its intrinsic resistance to TMZ, is an important barrier to successful treatment of GBM, and its inhibition can be a therapeutic strategy for its effective cure.

MMPs are a family of zinc-containing proteolytic enzymes, playing an important role in cancer metastasis, migration, invasion, growth, and angiogenesis. They catalyze the degradation of various components of the extracellular matrix (ECM). Among the more than twenty members of the MMPs family, MMP-2 and MMP-9 are especially important in gliomas oncogenesis since their expression is correlated with an increased grade of glioma malignancy and with tumor progression. The expression of the MMP-2 and MMP-9 genes in human glioma tissues is upregulated in comparison to the normal brain tissue and dramatically increased in GBMs.[27]

Increased expression and activity of MMP-2 and MMP-9 are correlated with an increased grade of glioma malignancy. Since the ability of tumor cells to migrate through the ECM is mainly attributed to their secretion of MMPs, inhibition of these enzymes reduces the invasiveness of glioma cells in vitro and in vivo and could be a suitable therapeutic option.[28] Subtoxic concentrations of TMZ are able to reduce invasion and migration of glioma cell lines.[29],[30] Furthermore, TQ inhibits glioblastoma cell migration, adhesion, and invasion in vitro through inhibiting of focal adhesion kinase, MMP-2 and MMP-9 mRNA expression.[12] We demonstrated that combination of TMZ and TQ reduces migration, invasion, and adhesion ability of U87MG cells significantly greater than each one alone, and this reduction is associated with a reduction in MMP-2 and MMP-9 secretion through downregulation of their genes.

 Conclusions



TMZ and TQ combination has synergistic effects on U87MG cells which lead to a reduced cell viability, decreased invasion, migration, and adhesion ability of the cells. These results could translate into beneficial effects of this combination in the management of GBM. The present data open a new possible approach in the treatment of GBM. Future in vivo studies are suggested.

Acknowledgments

This work was a part of a Ph.D. dissertation with grant number 93079. The authors would like to thank the Fertility and Infertility Research Center staff and Kermanshah University of Medical Sciences.

Financial support and sponsorship

This study was financially supported by the vice-chancellor for Research of kermanshah university of medical sciences.

Conflicts of interest

There are no conflicts of interest.

References

1Furnari FB, Fenton T, Bachoo RM, Mukasa A, Stommel JM, Stegh A, et al. Malignant astrocytic glioma: Genetics, biology, and paths to treatment. Genes Dev 2007;21:2683-710.
2Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ, et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 2005;352:987-96.
3Dehdashti AR, Hegi ME, Regli L, Pica A, Stupp R. New trends in the medical management of glioblastoma multiforme: The role of temozolomide chemotherapy. Neurosurg Focus 2006;20:E6.
4Hirose Y, Katayama M, Mirzoeva OK, Berger MS, Pieper RO. Akt activation suppresses Chk2-mediated, methylating agent-induced G2 arrest and protects from temozolomide-induced mitotic catastrophe and cellular senescence. Cancer Res 2005;65:4861-9.
5Caporali S, Falcinelli S, Starace G, Russo MT, Bonmassar E, Jiricny J, et al. DNA damage induced by temozolomide signals to both ATM and ATR: Role of the mismatch repair system. Mol Pharmacol 2004;66:478-91.
6Kanzawa T, Bedwell J, Kondo Y, Kondo S, Germano IM. Inhibition of DNA repair for sensitizing resistant glioma cells to temozolomide. J Neurosurg 2003;99:1047-52.
7Lu C, Shervington A. Chemoresistance in gliomas. Mol Cell Biochem 2008;312:71-80.
8Woo CC, Kumar AP, Sethi G, Tan KH. Thymoquinone: Potential cure for inflammatory disorders and cancer. Biochem Pharmacol 2012;83:443-51.
9Worthen DR, Ghosheh OA, Crooks PA. The in vitro anti-tumor activity of some crude and purified components of blackseed, Nigella sativa L. Anticancer Res 1998;18:1527-32.
10Cecarini V, Quassinti L, Di Blasio A, Bonfili L, Bramucci M, Lupidi G, et al. Effects of thymoquinone on isolated and cellular proteasomes. FEBS J 2010;277:2128-41.
11Gurung RL, Lim SN, Khaw AK, Soon JF, Shenoy K, Mohamed Ali S, et al. Thymoquinone induces telomere shortening, DNA damage and apoptosis in human glioblastoma cells. PLoS One 2010;5:e12124.
12Kolli-Bouhafs K, Boukhari A, Abusnina A, Velot E, Gies JP, Lugnier C, et al. Thymoquinone reduces migration and invasion of human glioblastoma cells associated with FAK, MMP-2 and MMP-9 down-regulation. Invest New Drugs 2012;30:2121-31.
13Torres S, Lorente M, Rodríguez-Fornés F, Hernández-Tiedra S, Salazar M, García-Taboada E, et al. A combined preclinical therapy of cannabinoids and temozolomide against glioma. Mol Cancer Ther 2011;10:90-103.
14Qi Q, Liu X, Li S, Joshi HC, Ye K. Synergistic suppression of noscapine and conventional chemotherapeutics on human glioblastoma cell growth. Acta Pharmacol Sin 2013;34:930-8.
15Jhaveri N, Cho H, Torres S, Wang W, Schönthal AH, Petasis NA, et al. Noscapine inhibits tumor growth in TMZ-resistant gliomas. Cancer Lett 2011;312:245-52.
16Jakubowicz-Gil J, Langner E, Badziul D, Wertel I, Rzeski W. Apoptosis induction in human glioblastoma multiforme T98G cells upon temozolomide and quercetin treatment. Tumour Biol 2013;34:2367-78.
17Lin CJ, Lee CC, Shih YL, Lin TY, Wang SH, Lin YF, et al. Resveratrol enhances the therapeutic effect of temozolomide against malignant glioma in vitro and in vivo by inhibiting autophagy. Free Radic Biol Med 2012;52:377-91.
18Filippi-Chiela EC, Thomé MP, Bueno e Silva MM, Pelegrini AL, Ledur PF, Garicochea B, et al. Resveratrol abrogates the temozolomide-induced G2 arrest leading to mitotic catastrophe and reinforces the temozolomide-induced senescence in glioma cells. BMC Cancer 2013;13:147.
19Chou TC. Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res 2010;70:440-6.
20Rezakhani L, Rashidi Z, Mirzapur P, Khazaei M. Antiproliferatory effects of crab shell extract on breast cancer cell line (MCF7). J Breast Cancer 2014;17:219-25.
21Hulkower KI, Herber RL. Cell migration and invasion assays as tools for drug discovery. Pharmaceutics 2011;3:107-24.
22Hirata H, Ueno K, Shahryari V, Deng G, Tanaka Y, Tabatabai ZL, et al. MicroRNA-182-5p promotes cell invasion and proliferation by down regulating FOXF2, RECK and MTSS1 genes in human prostate cancer. PLoS One 2013;8:e55502.
23Brassart-Pasco S, Sénéchal K, Thevenard J, Ramont L, Devy J, Di Stefano L, et al. Tetrastatin, the NC1 domain of the α4(IV) collagen chain: A novel potent anti-tumor matrikine. PLoS One 2012;7:e29587.
24Bijnsdorp IV, Giovannetti E, Peters GJ. Analysis of drug interactions. Methods Mol Biol 2011;731:421-34.
25Bozzuto G, Ruggieri P, Molinari A. Molecular aspects of tumor cell migration and invasion. Ann Ist Super Sanita 2010;46:66-80.
26Demuth T, Berens ME. Molecular mechanisms of glioma cell migration and invasion. J Neurooncol 2004;70:217-28.
27Könnecke H, Bechmann I. The role of microglia and matrix metalloproteinases involvement in neuroinflammation and gliomas. Clin Dev Immunol 2013;2013:914104.
28Wang-Gillam A, Siegel E, Mayes DA, Hutchins LF, Zhou Y. Anti-tumor effect of doxycycline on glioblastoma cells. J Cancer Mol 2007;3:147-53.
29Wick W, Wick A, Schulz JB, Dichgans J, Rodemann HP, Weller M. Prevention of irradiation-induced glioma cell invasion by temozolomide involves caspase 3 activity and cleavage of focal adhesion kinase. Cancer Res 2002;62:1915-9.
30Shen W, Hu JA, Zheng JS. Mechanism of temozolomide-induced antitumour effects on glioma cells. J Int Med Res 2014;42:164-72.