Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
ORIGINAL ARTICLE
Year : 2018  |  Volume : 14  |  Issue : 1  |  Page : 111-118

miR-150 contributes to the radioresistance in nasopharyngeal carcinoma cells by targeting glycogen synthase kinase-3β


1 Department of Otorhinolaryngology, The Second Affiliated Hospital, University of South China, Hengyang, China
2 Department of Emergency, The Fifth Affiliated Hospital, Southern Medical University, Guangzhou, China

Date of Web Publication8-Mar-2018

Correspondence Address:
Prof. Yuanjian Huang
Department of Otorhinolaryngology, The Second Affiliated Hospital, University of South China, Hengyang
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jcrt.JCRT_682_17

Rights and Permissions
 > Abstract 

Introduction: Radiotherapy has been the primary treatment for nasopharyngeal carcinoma (NPC), but the NPC radiocurability was severely limited with the radioresistance. The research suggested the important role of miRNAs in cancer therapeutic response.
Materials and Methods: A radioresistant NPC cell line CNE-2R, we exposed CNE-2 cells to a range of radiation doses. Levels of miR-150 were measured by quantitative reverse-transcriptase polymerase chain reaction in CNE-2R and CNE-2 cells.
Results: In this study, a cell line CNE-2R derived from parental CNE-2 was established via being exposed to stepwise escalated radiation dose. The expression of miR-150 was upregulated in CNE-2R cells. The radioresistance of CNE-2R cells was reversed after inhibiting miR-150 with specific inhibitor, while the radioresistance of CNE-2 cells was enhanced after the overexpression of miR-150. MiR-150b elicited these responses by directly targeting GSK3β. Moreover, GSK3β protein expression was downregulated in CNE-2R cells and restored GSK3β expression increased radiosensitivity of CNE-2R cells. Importantly, the negative correlation between miR-150 expression and GSK3β protein level was confirmed in the NPC tissues. High miR-150 expression and low GSK3β protein level were associated with poor prognosis in NPC patients.
Conclusion: Our findings suggested that miR-150-GSK3β axis may be a novel candidate for developing rational therapeutic strategies for NPC treatment.

Keywords: GSK3β, miR-150, nasopharyngeal carcinoma, radioresistance


How to cite this article:
Huang Y, Tan D, Xiao J, Li Q, Zhang X, Luo Z. miR-150 contributes to the radioresistance in nasopharyngeal carcinoma cells by targeting glycogen synthase kinase-3β. J Can Res Ther 2018;14:111-8

How to cite this URL:
Huang Y, Tan D, Xiao J, Li Q, Zhang X, Luo Z. miR-150 contributes to the radioresistance in nasopharyngeal carcinoma cells by targeting glycogen synthase kinase-3β. J Can Res Ther [serial online] 2018 [cited 2021 Jun 24];14:111-8. Available from: https://www.cancerjournal.net/text.asp?2018/14/1/111/226751


 > Introduction Top


Nasopharyngeal carcinoma (NPC) has been a squamous cell carcinoma derived from epithelial cells located in the nasopharynx, which was highly malignant with local invasion and early distant metastasis.[1] A unique feature of NPC was the remarkably unusual ethnic and geographic distribution in Southern China and Southeast Asia, especially in individuals of Cantonese origin. Radiotherapy is the primary treatment for patients with NPC. Although excellent local control can be achieved with advances in radiation therapy, success of the therapy has depended intensely on tumor stage. It documented that the 5-year overall survival (OS) rate of Stage I and II NPC ranged from 72% to 90% upon radiotherapy.[2] In contrast, the 5-year survival rates would drop to 55% in III and 30% in Stage IV NPC because of the high incidence of local recurrence. About 30%–40% of patients would develop distant metastasis within 4 years.[3],[4] Factually, radioresistance lead to recurrence and metastasis remained the major obstacle to successful treatment in NPC.[5] However, the molecular mechanisms responsible for the radioresistance of NPC were still not clear yet.

MicroRNAs (miRNAs or miRs) are a class of endogenous, short, conserved, noncoding RNAs that play important roles in many biological processes by posttranscriptionally regulating gene expression. MiRNAs bind to the 3'-untranslated regions (3'UTRs) of target mRNAs and then lead to mRNAs degradation or translation blockade.[6],[7] Recently, lots of reports have demonstrated that miRNAs were abnormally expressed in many cancers.[8],[9] Some miRNAs have been demonstrated to play important roles in progression, invasion, and metastasis in NPC such as miR-218, miR-141, and miR-26a.[10],[11],[12] Although some miRNAs have been reported to be involved in radioresistance of NPC such as miR-324,[13] miR-185,[14] and miR-205, the role of miRNAs in radioresistance of NPC remained far from a full understanding. In this study, we showed that miR-150 was upregulated in radioresistant NPC cell line CNE-2R compared to its parental cell line CNE-2, which targeted glycogen synthase kinase 3 beta (GSK3β). Our findings suggested that miR-150 was involved in the radioresistance of NPC cells and miR-150 was a potential biomarker to estimate the sensitivity of NPC.


 > Materials and Methods Top


Cell culture

CNE-2 and human embryonic kidney (HEK)-293 cell lines were obtained from Professor Hailin Tang (Sun Yat-sen University, Guangzhou, China). Human undifferentiated nonkeratinizing NPC cell line CNE-2 and its radioresistant derivate cell line CNE-2R were cultured in RPMI-1640 media (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco), and the HEK cell line (HEK-293T) were cultured in Dulbecco's Modified Eagle Medium (Gibico) supplemented with 10% fetal bovine serum in a humidified cell incubator with an atmosphere of CO2 at 37°C. To establish a radioresistant NPC cell line CNE-2R, CNE-2 cells were exposed to a range of radiation doses (1, 2, 4, 6, and 8 Gy) over a period of 12 months, referring to the description.[15]

Survival foci formation assay

Cells in exponential growth phase were plated into a 6-well plate with the density of 1500 cells/well and treated with a range of radiation doses (0, 3, and 6 Gy) after adhesion. Cell clones were stained with 0.06% crystal violet, and foci number was counted. The foci fraction was calculated by normalizing to the result of without treatment.

Cell proliferation assay

Cells were seeded into 96-well plates at 1000 cells/well (0.20 ml/well) and irradiated with 3 Gy or not. The cell proliferation assay was performed on 0, 1, 2, 3, 4, and 5 days by incubating with MTS (0.02 ml/well) (Promega, Madison, WI, USA). The absorbance of each well at 490 nm was recorded on the Biotex ELX800 and the absorbance value represented the cell number.

Hoechst staining

Cells were seeded into 24-well plates. After a 24 h incubation, cells were irradiated. Another 24 h later, the cells were stained with Hoechst 33528, and the nuclei of apoptotic cells were observed under a fluorescence microscope, which would be significantly smaller, condensed, and fragmented.

Real-time polymerase chain reaction for mature miRNAs and mRNA

The miRNAs and mRNAs were extracted simultaneously, which were isolated and purified with miRNA isolation system (Exiqon, Vedbaek, Denmark). For miRNA quantitative real-time (qRT)-polymerase chain reaction (PCR), cDNA was generated with the miScript II RT Kit (QIAGEN, Hilden, Germany) and the qRT-PCR was performed with the miScript SYBR Green PCR Kit (QIAGEN) following the manufacturer's instructions. The miRNA sequence-specific qRT-PCR primers for miR-150 and endogenous control RNU6 were purchased from QIAGEN, and the qRT-PCR analysis was performed with 7500 RT-PCR System (Applied Biosystems, Foster City, CA, USA). The gene expression threshold cycle (CT) values of miRNAs were calculated by normalizing with internal control RNU6 and relative quantization values were calculated. Total RNA was extracted with a Trizol protocol, and cDNAs from the mRNAs were synthesized with the SuperScript First-Strand Synthesis System (Thermo Scientific, Glen Burnie, MA, USA). RT-PCR was performed according to the standard protocol on ABI 7500 with SYBR Green detection (Applied Biosystems). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was applied as an internal control and the qRT-PCR was repeated three times. The primers for GAPDH were forward primer: 5'-ATTCCATGGCACCGTCAAGGCTGA-3', reverse primer 5'-TTCTCCATGGTGGTGAAGACGCCA-3'; for GSK3β were forward primer: 5'-GACTAAGGTCTTCCGACCCC-3', reverse primer: 5'-TTAGCATCTGACGCTGCTGT-3'.

Cells transfection

MiR-150 mimics, miR-150 inhibitor, and relative controls were purchased from Ambion (Foster City, CA, USA). Cells were trypsinized, counted, and seeded onto 6-well plates the day before transfection to ensure cell confluence of 70% on the day of transfection. The transfection of mimics, inhibitor, pLV-GFP-GSK3β vector, and related controls was performed according to the manufacturer's instructions.

Western blot

Total proteins were extracted from corresponding cells with the radioimmunoprecipitation assay buffer (Thermo Scientific, Rockford, IL, USA) in the presence of Protease Inhibitor Cocktail (Thermo Scientific). Equivalent amounts of protein were resolved and mixed with 5×Lane Marker Reducing Sample Buffer (Thermo Scientific, Rockford, IL, USA), electrophoresed in a 10% sodium dodecyl sulfate–acrylamide gel, and transferred onto Immobilon-P Transfer Membrane (Merck Millipore, Schwalbach, Germany). The signal was detected with an enhanced chemiluminescence detection system (Merck Millipore). The GSK3β antibody was obtained from Santa Cruz Biotechnology (Dallas, Texas, USA), and β-actin antibody was obtained from Cell Signaling Technology (Danvers, MA, USA). Horseradish peroxidase (HRP)-conjugated secondary antibody was also purchased from Thermo Scientific.

Luciferase reporter assay

For GSK3β, two single strands of the wild-type 3'UTR with miR-150 binding site and two single strands of the mutant type with five bases deleted in the miR-150 binding site (as mutant control) were synthesized with restriction sites for SpeI and HindIII located at both ends of the oligonucleotides for further cloning. The single-strand DNA sequences were following: the wild-type 3'UTR of GSK3β (sense: 5'-CTAGT GTGCACAGCTTGAAATTGGTTGGGAGCTTAGCAGGT ATAACTCAAC A-3'; antisense: 5'-AGCTT GTTGAGTTAT ACCTGCTAAGCTCCCAACCAATTTCAA GCTGTGCAC A-3') and the mutated type 3'UTR of GSK3β (sense: 5'-CTAGT GTGCACAGCTTGAAATTGG-------CTTAGCAGGTATAA CTCAAC A-3'; antisense: 5'-AGCTT GTTGAGTTATACCT GCTAAG-------CCAATTTCAAGCTG TGCAC A-3'). The corresponding sense and antisense strands were annealed and subsequently cloned into pMir-Report plasmid downstream of firefly luciferase reporter gene. Cells were seeded in 96-well plates and cotransfected with pMir-Report luciferase vector, pRL-TK Renilla luciferase vector, and miR-150 mimics expression vector. Then, the luciferase activities were determined with a Dual-Luciferase Reporter Assay System (Promega) where the Renilla luciferase activity was applied as internal control and the firefly luciferase activity was calculated as the mean ± SD after being normalized by Renilla luciferase activity. Three independent experiments were performed in triplicate.

Immunohistochemistry

The sections were dried at 55°C for 2 h and then deparaffinized in xylene and rehydrated with a series of graded alcohol washes. The tissue slides were then treated with 3% hydrogen peroxide in methanol for 15 min to quench endogenous peroxidase activity and antigen retrieval was then performed by incubating in 0.01 M sodium citrate buffer (pH 6.0) and heating with a microwave oven. After a 1 h preincubation in 10% goat serum, the specimens were incubated with primary antibody overnight at 4°C. The tissue slides were treated with a non-biotin HRP detection system according to the manufacturer's instruction (DAKO, Glostrup, Denmark). The immunohistological samples were evaluated by two different pathologists.

Statistical analysis

Statistical analysis was performed with SPSS software version 16.0 (IBM). Student's t-test was applied to evaluate the statistical significance. Survival curves were constructed with Kaplan–Meier method and analyzed by the log-rank test. P < 0.05 or 0.01 was set as the criteria for statistical significance.


 > Results Top


Biological characteristics of CNE-2R cells

A radioresistant NPC cell line was established in this study. To establish a radioresistant NPC cell line CNE-2R, we exposed CNE-2 cells to a range of radiation doses (1, 2, 4, 6, and 8 Gy) over a period of 12 months. To verify the radioresistant phenotype, we radiated CNE-2 and CNE-2R cells and examined them. CNE-2 and CNE-2R cells were irradiated with 0, 3, and 6 Gy. The results showed that more foci formation and higher survival fractions could be obtained when exposed to radiation. However, compared to CNE-2, CNE-2R showed no change of foci formation ability without radiation [Figure 1]a,[Figure 1]b,[Figure 1]c. The effect of radiation on cell growth was also examined by subjecting CNE-2 and CNE-2R cells to 3 Gy radiation. There were more cell numbers in CNE-2R cell line than that of in CNE-2 after radiation [Figure 1]d. CNE-2R cells were more radioresistant than parental CNE-2 cells. Additionally, CNE-2R cells showed more anti-apoptotic ability induced by radiation, compared to CNE-2 cells [Figure 1]e.
Figure 1: CNE-2R cell line is radioresistant. (a) CNE-2R cells were more radioresistant than CNE-2 cells. Indicated cells were treated with indicated dose of radiation and foci-formation was measured. (b) CNE-2R cells presented with more foci number than CNE-2 cells. The numbers of foci formation were presented as bar graphs. (c) CNE-2R cells presented with more foci fraction than CNE-2 cells. Foci fractions were calculated by dividing the number of colonies formed after radiation by the corresponding number of colonies formed without radiation from experiments in (b). (d) Less effects from radiation were observed on growth pattern of CNE-2R cells than that of CNE-2 cells. CNE-2R and CNE-2 cells were exposed to radiation dose of 3 Gy and cell growth was monitored by measuring cell numbers with MTS assay. (e) Additionally, CNE-2R cells showed more anti-apoptotic ability induced by radiation, compared to CNE-2 cells, which was detected by Hoechst staining. *P < 0.05, **P < 0.01

Click here to view


miR-150 enhanced radioresistance of CNE-2 cells

In this study, miR-150 was increased approximately by 6.20 times in CNE-2R cells compared with that of in CNE-2 cells [Figure 2]a. To investigate whether miR-150 has a direct role in regulating the radioresistance in CNE-2 cells, we inhibited miR-150 function in CNE-2R cells to further characterize its biological roles [Figure 2]b. The radiosensitivity of CNE-2R cells was significantly increased after miR-150 knockdown [Figure 2]d,[Figure 2]e,[Figure 2]f. Conversely, the ectopic expression of miR-150 in CNE-2 cells was achieved by miR-150 overexpression [Figure 2]c. The radioresistance was efficiently increased after the overexpression of miR-150 [Figure 2]g,[Figure 2]h,[Figure 2]i.
Figure 2: MiR-150 contributed to radioresistance in CNE-2 cells. (a) Compared to CNE-2 cells, miR-150 expression was increased in CNE-2R cells. (b and c) MiR-150 expression was detected with miR-150 inhibitors or mimics, respectively. (d-f) Knockdown of miR-150 reversed radioresistance of CNE-2R cells detected by foci formation assay. (g-i) Overexpression of miR-150 enhanced radioresistance of CNE-2 cells detected by foci formation assay. *P < 0.05

Click here to view


miR-150 directly targeted glycogen synthase kinase-3 β

To explore the roles of miR-150 involvement in radioresistance of NPC cells, the target gene was explored. GSK3β with conserved binding site was selected for further confirmation [Figure 3]a. The expression level of GSK3β was evaluated in CNE-2 and CNE-2R cells to investigate the correlation between miR-150 and GSK3β. The results showed that the expression of GSK3β protein in CNE-2R cells was much lower than that of in CNE-2 cells, without significant difference in mRNA level [Figure 3]b. Moreover, GSK3β protein level in CNE-2R cells was significantly increased with miR-150 inhibitor. Conversely, GSK3β protein level in CNE-2 cells was decreased with miR-150 mimics [Figure 3]c. To assess whether GSK3β was a direct target of miR-150, the luciferase reporter vectors with the putative GSK3β 3'UTR target site for miR-150 and mutant GSK3β 3'UTR target site were constructed. The luciferase activity of pMir-GSK3β-Wt in CNE-2R cells was downregulated by about 55.6% compared to that of in CNE-2 cells, without difference on luciferase activity of pMir-GSK3β-Mut. It suggested that GSK3β expression was posttranscriptionally suppressed by endogenous miR-150 [Figure 3]d. In addition, the luciferase reporter assay performed in HEK-293T cells showed that the luciferase activity of the vector was reduced by about 46.9% with miR-150 for the wild-type GSK3β, but the repressive role of miR-150 would be abrogated in the mutant-type GSK3β [Figure 3]e. These results demonstrated that GSK3β was the true target gene of miR-150.
Figure 3: MiR-150 targeted glycogen synthase kinase-3β. (a) Schematic of predicted miR-150 site in the 3'-untranslated region of glycogen synthase kinase-3β gene. (b) Glycogen synthase kinase-3β expression was much lower in CNE-2R cells compared to that of in CNE-2 cells at protein level, whereas without difference at mRNA level. (c) MiR-150 downregulated glycogen synthase kinase-3β protein expression. (d and e) MiR-150 suppressed the activity of the luciferase gene of the 3'-untranslated region of glycogen synthase kinase-3β. The mean of the results from CNE-2 cells transfected with pMir-Con, and HEK-293T cells transfected with pMir-Con and miR-150 control were set as 100%, respectively. *P < 0.05, **P < 0.01

Click here to view


GSK3 β overexpression reversed the radioresistance of CNE-2R cells

GSK3β was a direct target of miR-150 in CNE-2R cells. To investigate the role of GSK3β in NPC radiosensitivity, ectopic expression of GSK3β with pLV-GFP-GSK3β vector was applied. GSK3β protein level was significantly increased with pLV-GFP-GSK3β vector transfection in CNE-2R cells [Figure 4]a. Then, we observed the functional effect of restored GSK3β expression on radiosensitivity. It observed that radioresistance of CNE-2R cells could be significantly reversed with overexpressed GSK3β, which was detected by survival foci formation assay [Figure 4]b,[Figure 4]c,[Figure 4]d. Moreover, we found that the radioresistance induced by miR-150 mimics in CNE2 cells was abrogated with the ectopic GSK3β expression. These data indicated that radioresistance was mediated by miR-150 through regulating GSK3β expression in NPC cells.
Figure 4: Ectopic glycogen synthase kinase-3β expression reversed radioresistance of CNE-2R cells. (a) Overexpression of glycogen synthase kinase-3β increased glycogen synthase kinase-3β protein expression. (b-d) Overexpression of glycogen synthase kinase-3β reversed radioresistance of CNE-2R cells detected by foci formation assay. *P < 0.05

Click here to view


Prognostic value of miR-150/GSK3 β axis for NPC

To further investigate the role of miR-150/GSK3β axis in NPC, miR-150 expression was determined with qRT-PCR and GSK3β protein level was examined with immunohistochemistry. It analyzed the correlation between miR-150 and GSK3β expression in the 62 matched NPC tissues and adjacent nontumor tissues from the patients receiving radiotherapy. Compared with that of, in adjacent normal tissues, miR-150 was overexpressed in 24 (38.7%) NPC tissues [Figure 5]a. Seventeen of the 24 tissues with high miR-150 expression presented with low GSK3β protein level [Figure 5]a, whereas only 15 of the 38 tissues with low miR-150 expression presented with low GSK3β protein level [Figure 5]a. Thus, miR-150 expression was negatively correlated with GSK3β protein level in NPC [Figure 5]b. High miR-150 level was correlated with higher clinical stage, but high GSK3β level was correlated with lower clinical stage [Table 1]. Importantly, for the analysis of OS, the OS was significantly poorer in the high miR-150 expression group than that of in the low miR-150 expression group. Whereas, the OS was markedly better in high GSK3β protein levels group than that of in the low GSK3β protein level group [Figure 5]c. These analyses demonstrated that miR-150/GSK3β axis would be a valuable predictor for the survival of Hepatocellular carcinoma patients.
Figure 5: Prognostic value of miR-150/glycogen synthase kinase-3β axis for NPC. (a) MiR-150 expression in NPC tissues was examined by qRT-polymerase chain reaction and glycogen synthase kinase-3β protein level in NPC tissues was determined with immunohistochemical staining (×20). (b) miR-150 expression was negatively correlated with glycogen synthase kinase-3β protein level in tissues. (c) Kaplan–Meier analysis was applied to estimate overall survival according to the miR-150 expression level and glycogen synthase kinase-3β protein level

Click here to view
Table 1: Analysis of the correlation between miR-150 or GSK3βexpression and clinicopathologic parameters in NPC

Click here to view



 > Discussion Top


Chemoresistance and radioresistance have been the major clinical obstacles in cancer treatment.[9] Although mechanisms for therapeutic resistance have been extensively investigated with established chemo- or radio-resistant cell models including but not limited to Tca8113/PYM,[16] MCF-7/5-Fu,[17] MGR2R,[18] they have been still not fully understood. Recently, accumulating evidences have shown aberrant expression of certain miRNAs in almost every cancer type. The importance of miRNAs as potential prognostic indicators or therapeutic targets for cancers was concerned because of their functions in regulating fundamental cellular processes such as cell proliferation, differentiation, invasion, and apoptosis.[2] For example, miR-200b expression was significantly downregulated in docetaxel-resistant Non-small cell lung cancer cells.[19] MiR-200 was observed to reverse the resistance to epidermal growth factor receptor inhibitor therapy.[20] Recently, Sun et al. found that BMI1 expression could be reduced by the re-overexpression of miR-200b and miR-15b in cisplatin-resistant tongue cancer cells, and the cells could be sensitized to chemotherapy through epithelial–mesenchymal transition modulation.[21] In regard to NPC, radioresistance was the most important problem for successful treatment. Qu et al. showed that miR-205 enhanced the radioresistance in NPC by targeting phosphatase and tensin homolog.[2] Downregulation of miR324-3p [22] and miR-185-3p [23] contributed to radioresistance through upregulation of their target WNT2B. Although there have been a few reports focused on the role of miRNAs in radioresistance of NPC, the exact roles and mechanisms of miRNAs in radioresistance of NPC were still obscure.

To explore the mechanisms for radioresistance of NPC cells, some cell models have been established. However, considering the cancer heterogeneity and space-time quality, a radioresistant NPC cell line CNE-2R was established and we found that miR-150 was upregulated in CNE-2R cells. Expectedly, the radiosensitivity of CNE-2R cells was significantly increased after the miR-150 inhibition with specific inhibitor. However, the radioresistance of CNE-2 cells was obviously enhanced with the ectopic overexpression of miR-150 with miRNA mimics. MiR-150 was reported to promote tumorigenesis in different types of cancer. For example, miR-150 exerted its oncogenic roles through targeting the proapoptotic gene EGR2 in gastric cancer [24] and targeting the proapoptotic purinergic P2 × 7 receptor in epithelial cell cancer,[25] and miR-150 might be served as a potential biomarker for the prognosis and therapeutic outcome of colorectal cancer [26] and mixed lineage leukemia-associated leukemia.[27] Recently, studies suggested that miR-150 promoted the proliferation of lung cancer cells by targeting p53,[28] and it promoted the proliferation and migration of lung cancer cells by targeting SRC kinase signaling inhibitor 1.[29] Here, we demonstrated that miR-150 was involved in the radioresistance of NPC cells.

Referring to the mechanism of miR-150 in NPC cells, we found miR-150 directly targeted GSK3β whose protein expression was downregulated in CNE-2R cells with endogenous upregulation of miR-150 expression. GSK3β was a serine/threonine protein kinase involved in glycogen metabolism and the Wnt signaling pathway, which played important roles in embryonic development pathway and tumorigenesis.[30] Substrates could be phosphorylated with active GSK3β, such as β-catenin and Tau, resulting in ubiquitin-mediated degradation.[30] GSK3β activity could be abrogated by direct phosphorylation on the Ser9 residue by PI3K/Akt, MAPK/p90RSK, or mTOR/S6K upon a number of extracellular stimuli such as insulin, epidermal growth factor, or fibroblast growth factor.[31] GSK3β would be inactivated with Wnt signaling through the phosphorylation of Ser9 residue and prevented β-catenin from being phosphorylated, thus stabilizing GSK3β in the cytoplasm.[32] Overexpression of GSK3β could induce apoptosis in several cell types, whereas the apoptosis could be reduced with the inactivation of GSK3β. In NPC, Ma et al. recently reported that the inhibited GSK3β activity was associated with excessive Enhancer of zeste homolog 2 expression, which would enhance tumor invasion.[30] Many studies have shown clear regulatory mechanisms of GSK3β activity. In this study, we demonstrated that miR-150 could directly suppress GSK3β expression at protein level in NPC cells.


 > Conclusion Top


miR-150 was upregulated in CNE-2R cells and played roles in radioresistance in CNE-2 cells. Meanwhile, we found that miR-150 directly targeted GSK3β gene, and radioresistance in CNE-2R cells could be significantly reversed with ectopic GSK3β expression. Our findings suggested that miR-150-GSK3β axis would be a key biomarker for the radiosensitivity and would be worthy therapeutic strategies for NPC patients.

Financial support and sponsorship

This study was supported by the Science and Technology of Hunan Province (2014SK3081).

Conflicts of interest

There are no conflicts of interest.

 
 > References Top

1.
Liu X, Lu J, He ML, Li Z, Zhang B, Zhou LH,et al. Antitumor effects of interferon-alpha on cell growth and metastasis in human nasopharyngeal carcinoma. Curr Cancer Drug Targets 2012;12:561-70.  Back to cited text no. 1
    
2.
Qu C, Liang Z, Huang J, Zhao R, Su C, Wang S,et al. MiR-205 determines the radioresistance of human nasopharyngeal carcinoma by directly targeting PTEN. Cell Cycle 2012;11:785-96.  Back to cited text no. 2
    
3.
DeNittis AS, Liu L, Rosenthal DI, Machtay M. Nasopharyngeal carcinoma treated with external radiotherapy, brachytherapy, and concurrent/adjuvant chemotherapy. Am J Clin Oncol 2002;25:93-5.  Back to cited text no. 3
    
4.
Chang JT, Ko JY, Hong RL. Recent advances in the treatment of nasopharyngeal carcinoma. J Formos Med Assoc 2004;103:496-510.  Back to cited text no. 4
    
5.
Gupta AK, McKenna WG, Weber CN, Feldman MD, Goldsmith JD, Mick R,et al. Local recurrence in head and neck cancer: Relationship to radiation resistance and signal transduction. Clin Cancer Res 2002;8:885-92.  Back to cited text no. 5
    
6.
Tang H, Kong Y, Guo J, Tang Y, Xie X, Yang L,et al. Diallyl disulfide suppresses proliferation and induces apoptosis in human gastric cancer through wnt-1 signaling pathway by up-regulation of miR-200b and miR-22. Cancer Lett 2013;340:72-81.  Back to cited text no. 6
    
7.
Davis-Dusenbery BN, Hata A. MicoRNA in cancer: The involvement of aberrant microRNA biogenesis regulatory pathways. Genes Cancer 2010;1:1100-1.  Back to cited text no. 7
    
8.
Tang H, Deng M, Tang Y, Xie X, Guo J, Kong Y,et al. MiR-200b and miR-200c as prognostic factors and mediators of gastric cancer cell progression. Clin Cancer Res 2013;19:5602-12.  Back to cited text no. 8
    
9.
Xiao S, Yang Z, Lv R, Zhao J, Wu M, Liao Y,et al. MiR-135b contributes to the radioresistance by targeting GSK3β in human glioblastoma multiforme cells. PLoS One 2014;9:e108810.  Back to cited text no. 9
    
10.
Zhang L, Deng T, Li X, Liu H, Zhou H, Ma J,et al. MicroRNA-141 is involved in a nasopharyngeal carcinoma-related genes network. Carcinogenesis 2010;31:559-66.  Back to cited text no. 10
    
11.
Alajez NM, Lenarduzzi M, Ito E, Hui AB, Shi W, Bruce J,et al. MiR-218 suppresses nasopharyngeal cancer progression through downregulation of survivin and the SLIT2-ROBO1 pathway. Cancer Res 2011;71:2381-91.  Back to cited text no. 11
    
12.
Lu J, He ML, Wang L, Chen Y, Liu X, Dong Q,et al. MiR-26a inhibits cell growth and tumorigenesis of nasopharyngeal carcinoma through repression of EZH2. Cancer Res 2011;71:225-33.  Back to cited text no. 12
    
13.
Xu J, Ai Q, Cao H, Liu Q. MiR-185-3p and miR-324-3p Predict Radiosensitivity of Nasopharyngeal Carcinoma and Modulate Cancer Cell Growth and Apoptosis by Targeting SMAD7. Med Sci Monit 2015;21:2828-36.  Back to cited text no. 13
    
14.
Li G, Wang Y, Liu Y, Su Z, Liu C, Ren S, et al. miR-185-3p regulates nasopharyngeal carcinoma radioresistance by targeting WNT2B in vitro. Cancer Sci 2014;105:1560-8.  Back to cited text no. 14
    
15.
Qu C, Liang Z, Huang J, Zhao R, Su C, Wang S, et al. MiR-205 determines the radioresistance of human nasopharyngeal carcinoma by directly targetingPTEN. Cell Cycle 2012;11:785-96.  Back to cited text no. 15
    
16.
Zheng G, Zhou M, Ou X, Peng B, Yu Y, Kong F,et al. Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells. FEBS J 2010;277:4506-18.  Back to cited text no. 16
    
17.
Zheng G, Peng F, Ding R, Yu Y, Ouyang Y, Chen Z,et al. Identification of proteins responsible for the multiple drug resistance in 5-fluorouracil-induced breast cancer cell using proteomics analysis. J Cancer Res Clin Oncol 2010;136:1477-88.  Back to cited text no. 17
    
18.
Cheng JJ, Hu Z, Xia YF, Chen ZP. Radioresistant subline of human glioma cell line MGR2R induced by repeated high dose X-ray irradiation. Ai Zheng 2006;25:45-50.  Back to cited text no. 18
    
19.
Rui W, Bing F, Hai-Zhu S, Wei D, Long-Bang C. Identification of microRNA profiles in docetaxel-resistant human non-small cell lung carcinoma cells (SPC-A1). J Cell Mol Med 2010;14:206-14.  Back to cited text no. 19
    
20.
Adam L, Zhong M, Choi W, Qi W, Nicoloso M, Arora A,et al. MiR-200 expression regulates epithelial-to-mesenchymal transition in bladder cancer cells and reverses resistance to epidermal growth factor receptor therapy. Clin Cancer Res 2009;15:5060-72.  Back to cited text no. 20
    
21.
Sun L, Yao Y, Liu B, Lin Z, Lin L, Yang M,et al. MiR-200b and miR-15b regulate chemotherapy-induced epithelial-mesenchymal transition in human tongue cancer cells by targeting BMI1. Oncogene 2012;31:432-45.  Back to cited text no. 21
    
22.
Li G, Liu Y, Su Z, Ren S, Zhu G, Tian Y,et al. MicroRNA-324-3p regulates nasopharyngeal carcinoma radioresistance by directly targeting WNT2B. Eur J Cancer 2013;49:2596-607.  Back to cited text no. 22
    
23.
Li G, Wang Y, Liu Y, Su Z, Liu C, Ren S,et al. MiR-185-3p regulates nasopharyngeal carcinoma radioresistance by targeting WNT2B in vitro. Cancer Sci 2014;105:1560-8.  Back to cited text no. 23
    
24.
Wu Q, Jin H, Yang Z, Luo G, Lu Y, Li K,et al. MiR-150 promotes gastric cancer proliferation by negatively regulating the pro-apoptotic gene EGR2. Biochem Biophys Res Commun 2010;392:340-5.  Back to cited text no. 24
    
25.
Zhou L, Qi X, Potashkin JA, Abdul-Karim FW, Gorodeski GI. MicroRNAs miR-186 and miR-150 down-regulate expression of the pro-apoptotic purinergic P2X7 receptor by activation of instability sites at the 3'-untranslated region of the gene that decrease steady-state levels of the transcript. J Biol Chem 2008;283:28274-86.  Back to cited text no. 25
    
26.
Ma Y, Zhang P, Wang F, Zhang H, Yang J, Peng J,et al. MiR-150 as a potential biomarker associated with prognosis and therapeutic outcome in colorectal cancer. Gut 2012;61:1447-53.  Back to cited text no. 26
    
27.
Jiang X, Huang H, Li Z, Li Y, Wang X, Gurbuxani S,et al. Blockade of miR-150 maturation by MLL-fusion/MYC/LIN-28 is required for MLL-associated leukemia. Cancer Cell 2012;22:524-35.  Back to cited text no. 27
    
28.
Zhang N, Wei X, Xu L. MiR-150 promotes the proliferation of lung cancer cells by targeting P53. FEBS Lett 2013;587:2346-51.  Back to cited text no. 28
    
29.
Cao M, Hou D, Liang H, Gong F, Wang Y, Yan X,et al. MiR-150 promotes the proliferation and migration of lung cancer cells by targeting SRC kinase signalling inhibitor 1. Eur J Cancer 2014;50:1013-24.  Back to cited text no. 29
    
30.
Ma R, Wei Y, Huang X, Fu R, Luo X, Zhu X,et al. Inhibition of GSK 3β activity is associated with excessive EZH2 expression and enhanced tumour invasion in nasopharyngeal carcinoma. PLoS One 2013;8:e68614.  Back to cited text no. 30
    
31.
Forde JE, Dale TC. Glycogen synthase kinase 3: A key regulator of cellular fate. Cell Mol Life Sci 2007;64:1930-44.  Back to cited text no. 31
    
32.
Bitner RS, Nikkel AL, Markosyan S, Otte S, Puttfarcken P, Gopalakrishnan M,et al. Selective alpha7 nicotinic acetylcholine receptor activation regulates glycogen synthase kinase3beta and decreases tau phosphorylation in vivo. Brain Res 2009;1265:65-74.  Back to cited text no. 32
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
 
 
    Tables

  [Table 1]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Conclusion>Article Figures>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed1945    
    Printed12    
    Emailed0    
    PDF Downloaded70    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]