|
 
 |
| ORIGINAL ARTICLE |
|
| Year : 2016 | Volume
: 12
| Issue : 1 | Page : 198-203 |
|
Dendritic cell vaccination enhances antiangiogenesis induced by endostatin in rat glioma
Xia Zhou1, Yiwei Liao2, Haoyu Li2, Zijin Zhao2, Qing Liu2
1 Department of Ophthalmology, Xiangya Hospital of Central South University, Changsha, Hunan, China
2 Department of Neurosurgery, Xiangya Hospital of Central South University, Changsha, Hunan, China
| Date of Web Publication | 13-Apr-2016 |
Correspondence Address:
Qing Liu
87 # Xiang-Ya Road, Changsha - 410 078, Hunan
China
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/0973-1482.151430
Context: It has been verified that dendritic cell (DC) vaccination can improve the prognosis of malignant glioma. However, recent evidence suggests the problems with DC vaccines lies, at least in part, with the cancers ability to induce an immunosupressive response that suppresses any vaccine-mediated active immunity. Our previous studies indicate that subcutaneous vaccine can restrain the cancer cells implanted in the brain, but the effect is limited on vascularized tumor in the brain. Furthermore, vascular endothelial growth factor (VEGF) and vascular cell adhesion molecule (VCAM) play an important role in immunoevasion.
Aims: To identify the effects of DC vaccination on antiangiogenesis induced by endostatin in rat glioma.
Materials and Methods: Rat basal ganglia glioma model was constructed and authenticated. The concentration of immunoglobulin G (IgG) was detected using rat IgG enzyme-linked immunosorbent assay (ELISA) kit. CD8+ T cell infiltration was measured by immunofluorescence. The expression of VEGF, VCAM, and intercellular adhesion molecule 1 (ICAM-1) tested by real-time reverse transcription-polymerase chain reaction (qRT-PCR) and Western blot. The expression of VEGF and apoptosis in rat glioma tissues is tested by immunohistochemical staining.
Statistical Analysis Used: Two group comparisons were analyzed by a two-tailed Student's t test. Multiple group comparisons were analyzed by one-way analysis of variance (ANOVA). P values less than 0.05 were considered statistically significant.
Results: The combination of DC vaccination and antiangionesis inhibited the rats with malignant glioma by stimulating immune response, supressing the expression of angiogenesis-related proteins VEGF, VCAM, and ICAM-1. In addition, the combination therapy inhibited glioma stem–cell-like cells.
Conclusions: DC vaccination enhances antiangiogenesis induced by endostatin in rat glioma.
Keywords: DC, endostatin, glioma, tumor stem cell, immunity therapy
How to cite this article:
Zhou X, Liao Y, Li H, Zhao Z, Liu Q. Dendritic cell vaccination enhances antiangiogenesis induced by endostatin in rat glioma. J Can Res Ther 2016;12:198-203 |
| > Introduction | |  |
Glioma is the most common primary brain tumor in adults. It responds poorly to conventional operation and chemistry treatments.[1] Recent studies suggest glioblastoma is initiated from glioma stem-like cells (GSCs).[2] Immunotherapy of malignant gliomas with autologous dendritic cells (DCs) in addition to surgery and radiochemotherapy has been a focus of intense research during the past decade.[3] This makes glioma cells a potential target population for immunotherapy strategies. One of the most promising strategies may be active immunotherapy, using DC vaccination to enable the host immune system to distinguish and eradicate glioma cells.[4]
DCs are the most potent antigen-presenting cells of the immune system and have been demonstrated to stimulate antibody and cell-mediated immune responses against tumor-associated antigens. Ex vivo-generated and tumor antigen-loaded DCs have been successfully introduced to clinical vaccination protocols, which have proven to be feasible and effective in some glioma patients. Most importantly, immunotherapy, followed by chemotherapy could significantly increase 2-year survival in malignant glioma patients, which obviously demonstrates that DC vaccination could increase the sensitivity of tumor cells to chemotherapy.[5]
Anti-angiogenic therapy has been a major clinical research focus in neuro-oncology over the past 5 years.[6] The currently available treatment approaches acting against angiogenesis are mainly directed toward three pathways: Vascular endothelial growth factor (VEGF) pathway, VEGF-independent pathways, and inhibition of vascular endothelial cell migration.[7] Endostatin has been proven to be beneficial as an anti-angiogenic agent in experimental gliomas, but the effects are unclear. Endostatin was showed to reduce glioma-induced edema and vascular permeability.[8]
In this study, we first constructed and authenticated basal ganglia glioma rat model. We then sought to investigate the effect of C6 cell lysate-pulsed DCs combined with or without anti-angiogenesis agent endostatin in vitro and in vivo and observed that such DCs elicited a stronger specific effect of anti-angiogenesis. The effect of C6 cell lysate-pulsed DCs suppressed C6 cell stem cells.
| > Subjects and Methods | | |
Cell line and animals
The rat C6 glioma cell line was obtained from Cell bank Chinese Academy of Sciences (Shanghai, China). C6 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Life Technologies, San Diego, CA, USA) containing 10% fetal bovine serum (FBS, Life Technologies) and 1% Penicillin–Streptomycin (Sigma, St. Louis, MO, USA). Sprague Dawley (SD) male rat (6–8 weeks old) were obtained from the Chinese Scientific Institute (Beijing, China) and treated in accordance with the Animal Research guidelines of Xiangya Hospital, Central South University.
Rat glioma model and histology
SD rat were anesthetized with pentobarbital (50 mg/kg intraperitoneally) and placed in a stereotactic frame. C6 cells (2 × 106 in 10 μL PBS) were implanted in the caudate nucleus of SD rat. Rat were observed and weighed every 2 days, and treated with therapy after operated 14 days. Brains were surgically removed and fixed with 10% neutral formalin. The fixed brains were cut through the implantation site to identify gross gliomas, and embedded in paraffin. Thin sections of 5 μm were cut and mounted on glass slides. Histopathological features were studied in sections stained with hematoxylin and eosin (H and E). To detect T cell infiltration, sections were stained with anti-CD8 antibody (Abcam, Cambridge, MA, USA) according to the manufacturer's instructions. For antigen retrieval, slides were boiled in 10 mM citrate buffer (pH 6.0) for 10 min before commencing with immunohistochemical staining.
Monitoring of glioma growth and rat immune response
To determine the course of glioma growth and rat immune response, rats were sacrificed at 7-day intervals after C6 implantation. Histology of each brain specimen was studied, and behavior score for each rat was calculated. Serum was isolated, and the concentration of immunoglobulin G (IgG) was detected by enzyme-linked immunosorbent assay (ELISA) using rat IgG ELISA kit (Guangrui Biotech, Shanghai, China).
Preparation of DC vaccines
DCs were derived from bone marrow of naive SD rat. Bone marrow cells were cultured at a density of 1.5 × 106 cells/mL in Roswell Park Memorial Institute 1640 (Life Technologies) containing 15% FBS, 10 ng/mL mGM-CSF (Miltenyi Biotec), 10 ng/mL mIL-4 (Miltenyi Biotec), and 1% penicillin–streptomycin. On day 1, floating cells were removed and on day 4, fresh medium containing mGM-CSF and mIL-4 was replenished. On day 7, non-adherent and loosely adherent clusters of immature DCs were harvested. Lysates of unsorted C6 cells (cultured in serum-free medium), C6 cells were prepared by three freeze–thaw cycles (liquid nitrogen, 37°C water bath). The disrupted cells were centrifuged at 6009 g for 10 min, filtered through a 0.2 lm membrane and stored at -20°C. The immature DCs were incubated with three lysates, respectively, at a ratio of three C6 cell equivalents to one DC. After overnight incubation, mature DCs were harvested. Both immature and mature DCs were analyzed by flow cytometry with antibodies against OX-6 and CD80 (Sigma).
Tumor sphere culture, cell sorting
C6 cells were resuspended in serum-free medium, consisting of DMEM/F12 (Life Technologies), 20 ng/mL recombinant EGF (Life Technologies), 20 ng/mL bFGF (Life Technologies), 2% B27 (Life Technologies), and 1% penicillin–streptomycin. Tumor spheres were collected, passaged, and maintained in serum-free medium.
Immunotherapy in vivo
SD rats were intracranially implanted with 2 × 106 C6 cells (cultured in DMEM containing 10% FBS) on day 0. Vaccinations started at day 3: Rats were subcutaneously vaccinated with C6 cell lysate-pulsed DCs, or unsorted C6 cell lysate-pulsed DCs, or C6 cell lysate-pulsed DCs combining with/without endostatin (10 mg/kg.d) on for 1 week.
Immunohistochemical staining
Immunohistochemical staining were performed using the UltraSensitive S-P Kit (Maixin Biotechnology Company, Fuzhou, China) and color was developed using DAB as chromogen, counterstained with Mayer's hematoxylin and mounted for evaluation using microscope (OLYMPUS BX-51, Osaka, Japan). Two independent pathologists blinded to the clinicopathological information performed scoring. Staining was scored for determining the intensity (1, 0+; 2, 1+; 3, 2+; 4, 3+) and percentage of membranous and cytoplasmic staining in malignant cells (1, 0–25%; 2, 26–50%; 3, 51–75%; 4, 76–100%). The score of intensity multiplied by the score of percentage counts was used as the final score. A score of <8 was considered as a low-level expression and that of >8 was considered as a high-level expression.
Immunofluorescence
Sections of formalin-fixed paraffin-embedded breast tumors were deparaffinized in xylene, 15 min, followed by 10 min each in serial dilution of ethanol (100%, 100%, 95%, and 95%) and followed by two changes of water. Antigen unmasking was achieved by boiling the slides (95–99°C) for 10 min, in 10 mM sodium citrate buffer pH 6.0. Sections were then rinsed three times in ddH2O, one time in PBS, and blocked for 1 hour in blocking solution (5% goat serum, 300 ml Triton X-100 in 100 ml PBS). Glial fibrillary acidic protein (GFAP) antibodies were diluted (1:200) and applied on sections overnight at 4°C. Next, slides were washed three times, in PBS for 5 min each, blocked for 1 hour in blocking solution, and incubated with Cy2-conjugated anti-goat antibody diluted 1:500 for 1 hour at room temperature in the dark. Slides were washed three times, in PBS for 5 min each, and coverslipped in Vectashield mounting medium with 4',6-diamidino-2-phenylindole (DAPI). Images were obtained as described above.
RNA isolation and qRT-PCR
Total ribonucleic acids (RNAs) were extracted from cells with TRIzol reagent (Invitrogen). For the detection of VEGF, vascular cell adhesion molecule (VCAM), and intercellular adhesion molecule 1 (ICAM-1) messenger RNA (mRNA), complementary deoxyribonucleic acid (cDNA) was synthesized from 1 μg of total RNA by means of the reverse reaction kit according, which was used in accordance with the manufacturer's instructions (Promega). Human GAPDH was amplified in parallel as an internal control. The primers were: VEGF forward primer: 5' GGGGGATCCGCCTCCGAAACCATGAACTT', reverse primer: 5' CCCGAATTCTCCTGGTGAGAGA-TCTGGTT 3'; VCAM forward primer: 5' CTGGGAAGCTGGAACGAAGTA 3', reverse primer: 5' GCCACTGAATTGAATCTCTGGAT 3'; ICAM-1 forward primer: 5' GGTGGGC AAGAACCTCATCCT 3', reverse primer: 5' CTGGCGGCT CAGTGTCTCATT 3'. The expression of each gene was quantified by measuring cycle threshold (Ct) values and normalized using the 2-γγCt method relative to GAPDH.
Western blot
Protein lysates from cells were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and target proteins were detected with primary antibodies recognizing CD133 (Santa Cruz, USA), VEGF, and GAPDH (Cell Signaling), respectively. After incubation with appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch), protein bands were visualized using enhanced chemiluminescence (ECL) plus Western blotting detection reagents followed by exposure to Bio Image Intelligent Quantifier 1-D (Version 2.2.1, Nihon-BioImage Ltd., Japan).
Statistical analysis
Two group comparisons were analyzed by a two-tailed Student's t test. Multiple group comparisons were analyzed by one-way analysis of variance (ANOVA). P values less than 0.05 were considered statistically significant.
| > Results | | |
Characterization of DCs by flow cytometry
Flow cytometric analysis demonstrated an increased expression of CD80 and OX-6 in DCs treated with lysates of unsorted C6 cells compared with control DCs [Figure 1]. | Figure 1: Expression of surface molecules on different groups of dendritic cells (DCs) was detected by flow cytometry
Click here to view |
Construction and authentication of rat basal ganglia glioma model
As is shown in [Figure 2]a, transplanted tumor could be seen by eyes. In rat basal ganglia, glioma cells were seen by H and E staining [Figure 2]b. GFAP protein a marker of glioma was widely expressed in glioma cells in rat basal ganglia tested by immunofluorescence [Figure 2]c. It could be said that the rat basal ganglia glioma model was successfully constructed. | Figure 2: Construction and authentication of rat basal ganglia glioma model. (a) Schema and pathological imaging of constructed rat basal ganglia glioma model. (b) Rat basal ganglia stained with H and E. (c) Glial fibrillary acidic protein (GFAP) in rat basal ganglia tested by immunofluorescence
Click here to view |
DC vaccination therapy enhance the immune response caused by endostatin in glioma
Firstly, we detected the effect of endostatin on IgG titer in glioma cells. The results showed that endostatin could increase the IgG titer in glioma cells [Figure 3]a left. The level of serum IgG in the DC-treated group and DC combining with endostatin-treated group was upregulated than in control group. And, among these three groups, the level of IgG was the highest in the DC combining with endostatin treated group [Figure 3]a right. Then we measured CD8 + T cell infiltration. Infiltration of CD8 + T cells in transplant tumor was remarkably increased in the DC combining with endostatin treated group than in the control and DC treated group [Figure 3]b. | Figure 3: Dendritic cell (DC) vaccination therapy enhance the immune response caused by endostatin. (a) Serum levels of immunoglobulin G (IgG). Rats (n = 10) were adoptively transferred with DC vaccines generated by the methods described. After the last vaccination, serum was analyzed by enzyme-linked immunosorbent assay (ELISA) for IgG. The data are expressed as the mean ± standard deviation (SD) of 3 observations. *P < 0.05, **P < 0.01 compared with the control group. (b) CD8 + T cell infiltration was measured by immunofluorescence, ES: Endostatin
Click here to view |
DC vaccination enhanced the inhibition effect of rat glioma progression induced by endostatin
As is shown in [Figure 4]a, C6 cell lysate-pulsed DCs vaccination could decrease the tumor size in basal ganglia glioma rat. The tumor size of the rat treated with DC vaccination and endostatin was the smallest. Then we detected the expression of angiogenesis-associated gene VEGF, VCAM, and ICAM-1. The mRNA and protein level of VEGF, VCAM, and ICAM-1 was the lowest in the DC vaccination combining endostatin group. The mRNA and protein expression of these three genes was downregulated in DC vaccination group compared to the control [Figure 4]b and [Figure 4]c. The VEGF expression in transplant tumor tissues was detected by immunohistochemical staining. The VEGF was remarkbly downregulated in DC vaccination combining endostatin group [Figure 4]d. Then we test the apoptosis in transplant tumor tissues by TUNNEL. The number of apoptosis cells was the largest in DC vaccination combining endostatin group [Figure 4]d. | Figure 4: Dendritic cell (DC) vaccination enhanced the inhibition effect of rat glioma progression induced by endostatin. (a) Monitoring of glioma growth by pathological imaging. (b) Messenger ribonucleic acid (mRNA) levels of vascular endothelial growth factor (VEGF), vascular cell adhesion molecule (VCAM), and intercellular adhesion molecule 1 (ICAM-1) tested by real-time reverse transcription-polymerase chain reaction (qRT-PCR). The data are expressed as the mean ± standard deviation (SD) of three observations. *P < 0.05, **P < 0.01 compared with the control group. (c) Protein expression of VEGF, VCAM, and ICAM-1 detected by Western blot. (d) The expression of VEGF and apoptosis in rat glioma tissues tested by immunohistochemical staining. ES: Endostatin
Click here to view |
DC combining with endostatin inhibits rat glioma stem cell-like cells
Firstly, we isolated C6 cell stem cells from C6 cell lines [Figure 5]a. The C6 cell stem cells were co-cultured with DC and/or endostatin. The sphere formation ability of C6 cell stem cells was decreased in DC vaccination group and in DC vaccination combining endostatin group. And the sphere formation ability of C6 cell stem cells was the most inhibited in DC vaccination combining endostatin group [Figure 5]b. At last, we detected the expression of glioma stem cells markers in C6 cell stem cells. It is showed that the expression of Nestin and CD133 was downregluated in DC vaccination combining endostatin group [Figure 5]c. | Figure 5: Dendritic cell (DC) combining with endostatin inhibits rat glioma stem cell-like cells. (a) Isolationg and authentication of C6 cell stem cells by immunofluorescence. (b) The sphere formation ability of C6 cell stem cells. (c) The expression of glioma stem cell markers Nestin and CD133 detected by flow cytometry. ES: Endostatin
Click here to view |
| > Discussion | | |
In this study, we validated in vivo the concept of tumor immunotherapy with ex vivo C6 cell lysate-loaded DCs in the context of malignant glioma. Moreover, the inevitable link between active immunotherapy and anti-angiogenesis therapy was also investigated.
DCs are the most effective antigen presenting cells in the human immune system. Initially, the central nervous system was considered to be immunologically privileged due to the blood–brain barrier. More recent data, however, support a high level of cellular and molecular interaction between brain tumors and the immune system.[9] Using DC-based vaccines for treatment of gliomas has emerged as a meaningful and feasible treatment approach for inducing long-term survival, but this approach so far has failed to generate significant clinical responses.[10] Some glioma models are well-established in immunotherapy research, like murine GL261 glioma model.[11] But none of them can reflect the actually situation in brain. In this study, we established rat basal ganglia glioma model in order to better elucidate the glioma treatment effect of DC vaccination.
This study also shows that a tumor-specific vaccine is capable of inducing specific immune responses in a majority of patients with Glioblastoma multiforme.[12],[13] This study also shows that cell lysate vaccine is capable of inducing immune responses in rats with GBM.
Angiogenesis plays a central role in tumor growth and metastasis. Since GBM tumors are highly vascularised, therapeutic strategies based on angiogenic blockade are particularly attractive for this entity. An additional aspect to be considered for the design of novel therapeutic strategies against GBM is the ability of these tumors to escape anti-angiogenic monotherapy.[14] Although the inhibition of angiogenesis is an established modality of cancer treatment, concerns regarding toxicity and drug resistance still constitute barriers to be overcome. For almost a decade, since the approval of bevacizumab, the efforts on antiangiogenic therapeutics have been mainly focused in inhibiting the VEGF pathway.[15] Endostatin has been proven to be beneficial as an anti-angiogenic agent in experimental gliomas.[16] It is reported that endostatin therapy induced a significant increase in both T CD4 and CD8 cells in the lymph nodes and the spleen in a metastatic renal cell carcinoma model.[17] Accordingly, our approach was designed to target angiogenic signaling pathways and to investigate the effect of the combination of DC vaccine and endostatin in a GBM model. Our results showed that C6 cell lysate-pulsed DCs vaccination could enhance the immune response caused by endostatin in glioma and the combination of C6 cell lysate-pulsed DCs vaccination and endostatin could derease the tumor size in basal ganglia glioma rat.
The high malignancy of glioblastoma has been recently attributed to the presence, within the tumor, of glioblastoma stem cells (GSC) poorly responsive to chemo- and radiotherapy.[18] It is reported that oncolytic virus carrying endostatin-angiostatin fusion gene targeted glioblastoma stem cells and inhibited the proliferation.[19] In our study, we detected the effects of DC combining with endostatin on rat glioma stem cell-like cells. The results showed that the combination could inhibit sphere formation ability and expression of Nestin and CD133.
The main objective of the work presented in this study was better insight into the effect of DC vaccine combining with endostatin on glioma and glioma stem cell-like cells. This work opens perspectives for a further detailed study of DC vaccine to suppressing angiogenesis. In conclusion, we postulate from the in vitro and in vivo data presented here that the combination of immunotherapeutic approach and antiangiogenesis leads to optimal immunological protection against malignant glioma and inhibiting glioma stem cell-like cells in rat.
| > References | | |
| 1. | Dodoo E, Huffmann B, Peredo I, Grinaker H, Sinclair G, Machinis T, et al. Increased survival utilizing delayed gamma knife radiosurgery for recurrent high grade glioma: A feasibility study. World Neurosurg 2014;82:e623-32.  |
| 2. | Modrek AS, Bayin NS, Placantonakis DG. Brain stem cells as the cell of origin in glioma. World J Stem Cells 2014;6:43-52. |
| 3. | Eyrich M, Rachor J, Schreiber SC, Wolfl M, Schlegel PG. Dendritic cell vaccination in pediatric gliomas: Lessons learnt and future perspectives. Front Pediatr 2013;1:12. |
| 4. | Chang CN, Huang YC, Yang DM, Kikuta K, Wei KJ, Kubota T, et al. A phase I/II clinical trial investigating the adverse and therapeutic effects of a postoperative autologous dendritic cell tumor vaccine in patients with malignant glioma. J Clin Neurosci 2011;18:1048-54. |
| 5. | Liu G, Black KL, Yu JS. Sensitization of malignant glioma to chemotherapy through dendritic cell vaccination. Expert Rev Vaccines 2006;5:233-47. |
| 6. | Rinne ML, Lee EQ, Nayak L, Norden AD, Beroukhim R, Wen PY, et al. Update on bevacizumab and other angiogenesis inhibitors for brain cancer. Expert Opin Emerg Drugs 2013;18:137-53. |
| 7. | De Bonis P, Marziali G, Vigo V, Peraio S, Pompucci A, Anile C, et al. Antiangiogenic therapy for high-grade gliomas: Current concepts and limitations. Expert Rev Neurother 2013;13:1263-70. |
| 8. | Yang LJ, Lin ZX, Kang DZ, Weng SM, Lin JH, Huang Q, et al. Effects of endostatin on C6 glioma-induced edema. Chin Med J (Engl) 2011;124:4211-6. |
| 9. | Kushchayev SV, Kushchayeva YS, Wiener PC, Scheck AC, Badie B, Preul MC. Monocyte-derived cells of the brain and malignant gliomas: The double face of janus. World Neurosurg 2012. |
| 10. | Zhang H, Tian M, Xiu C, Wang Y, Tang G. Enhancement of antitumor activity by combination of tumor lysate-pulsed dendritic cells and celecoxib in a rat glioma model. Oncol Res 2013;20:447-55. |
| 11. | Fecci PE, Sweeney AE, Grossi PM, Nair SK, Learn CA, Mitchell DA, et al. Systemic anti-CD25 monoclonal antibody administration safely enhances immunity in murine glioma without eliminating regulatory T cells. Clin Cancer Res 2006;12:4294-305. |
| 12. | He SJ, Gu YY, Yu L, Luo B, Fan R, Lin WZ, et al. High expression and frequently humoral immune response of melanoma-associated antigen D4 in glioma. Int J Clin Exp Pathol 2014;7:2350-60. |
| 13. | Lowenstein PR, Castro MG. The value of EGFRvIII as the target for glioma vaccines. Am Soc Clin Oncol Educ Book 2014:42-50. |
| 14. | Oliveira-Ferrer L, Wellbrock J, Bartsch U, Penas EM, Hauschild J, Klokow M, et al. Combination therapy targeting integrins reduces glioblastoma tumor growth through antiangiogenic and direct antitumor activity and leads to activation of the pro-proliferative prolactin pathway. Mol Cancer 2013;12:144. |
| 15. | Limaverde-Sousa G, Sternberg C, Ferreira CG. Antiangiogenesis beyond VEGF inhibition: A journey from antiangiogenic single-target to broad-spectrum agents. Cancer Treat Rev 2014;40:548-57. |
| 16. | Zhang Y, Zhang J, Jiang D, Zhang D, Qian Z, Liu C, et al. Inhibition of T-type Ca (2) (+) channels by endostatin attenuates human glioblastoma cell proliferation and migration. Br J Pharmacol 2012;166:1247-60. |
| 17. | Chaves KC, Peron JP, Chammas R, Turaca LT, Pesquero JB, Braga MS, et al. Endostatin gene therapy stimulates upregulation of ICAM-1 and VCAM-1 in a metastatic renal cell carcinoma model. Cancer Gene Ther 2012;19:558-65. |
| 18. | Carmignani M, Volpe AR, Aldea M, Soritau O, Irimie A, Florian IS, et al. Glioblastoma stem cells: A new target for metformin and arsenic trioxide. J Biol Regul Homeost Agents 2014;28:1-15. |
| 19. | Zhu G, Su W, Jin G, Xu F, Hao S, Guan F, et al. Glioma stem cells targeted by oncolytic virus carrying endostatin-angiostatin fusion gene and the expression of its exogenous gene in vitro. Brain Res 2011;1390:59-69. |
[Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
|
Related articles