Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 16  |  Issue : 1  |  Page : 120-126

Clinicopathological spectrum of hairy-cell leukemia: A single-center study with brief review of Indian literature


Department of Hematology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow, Uttra Pradesh, India

Date of Submission06-Nov-2017
Date of Decision07-Mar-2018
Date of Acceptance28-May-2018
Date of Web Publication26-Oct-2018

Correspondence Address:
Khaliqur Rahman
Department of Hematology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow, Uttar Pradesh
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jcrt.JCRT_920_17

Rights and Permissions
 > Abstract 


Objective: The presence of specific chemotherapeutic protocols for hairy cell leukemia (HCL) makes it essential to discriminate this entity from other lymphoproliferative disorders. Hence, awareness of the variations in clinical presentations and immunophenotypic aberrancies is requisite to ensure diagnostic accuracy.
Materials and Methods: A retrospective study was carried out to analyze the clinical-pathological profile of patients with HCL diagnosed over a period of 81 months (2010–September 2017) in our institute. Flow cytometry was performed in all the patients, and further, BRAFV600E mutation analysis was performed by real-time polymerase chain reaction in a limited number of samples.
Result: A total of 353 lymphoproliferative disorders were assessed during the period, of which 16 (4.5%) were diagnosed as HCL, which included 15 cases of classical HCL and single case of HCL-v. Striking male predominance was noted with a median age of 52 (range 22–90 years). 47% patients presented with pancytopenia, while 20% cases had leukocytosis. Three patients presented with bleeding diathesis in the form of melena and purpuric spots. The absence of splenomegaly was observed in 20% patients (4/15) while 2 (13.3%) cases had lymphadenopathy. Hypocellular marrow was observed in 13% cases. Bright expression of CD20/CD22 along with CD25/CD103/CD123/CD11c was noted in all the patients of classical HCL. Aberrant expression of CD23 and CD5 was seen in 33% ( n =5) and 6.7% ( n =1) cases respectively. CD200 was positive in all the 5/15 cases tested. The case of HCL–v presented with very high leukocyte count and exhibited a CD103/CD11c+ and CD123/CD25- profile. BRAFV600E, mutation was present in all the four patients tested who included patients with a hypocellular marrow and absent splenomegaly.
Conclusion: HCL has characteristic profiles, yet it may exhibit unusual clinical and immunophenotypic presentations. Perspicacious use of flow cytometry and BRAFV600E mutation analysis will aid in the diagnosis in unprecedented cases.

Keywords: BRAF mutation, flow cytometry, hairy-cell leukemia, morphology


How to cite this article:
Gupta R, Yadav S, Mittal N, Rahman K, Sharma A, Gupta A, Nityan S. Clinicopathological spectrum of hairy-cell leukemia: A single-center study with brief review of Indian literature. J Can Res Ther 2020;16:120-6

How to cite this URL:
Gupta R, Yadav S, Mittal N, Rahman K, Sharma A, Gupta A, Nityan S. Clinicopathological spectrum of hairy-cell leukemia: A single-center study with brief review of Indian literature. J Can Res Ther [serial online] 2020 [cited 2020 Jun 6];16:120-6. Available from: http://www.cancerjournal.net/text.asp?2020/16/1/120/244241




 > Introduction Top


Hairy-cell leukemia (HCL) is a distinct form of a low-grade B-cell lymphoproliferative disorder which constitutes approximately 2% of all leukemias.[1],[2] It is primarily a disorder of the elderly males and characterized by splenomegaly, pancytopenia with conspicuous monocytopenia. The neoplastic lymphoid cells are monotonous appearing and exhibit circumferential 'hairy or villous projections' which on scanning electron microscopy are appreciated as large undulating ruffles ridges or folds, as well as interspersed finger-like projections.[3] The diagnosis of cases with these classical features in adjunct to immunophenotyping may be straightforward; however, HCL is known for numerous other unusual clinical, morphological, and immunophenotypic variations. The presence of leukocytosis, lymphadenopathy, a hypoplastic marrow, and absence of splenomegaly are infrequently reported.[4],[5] Rarer still is the involvement of the musculoskeletal system, skin lesions, auto-immune hemolytic anemia, and isolated neurological manifestations at diagnosis, which has been reported as anecdotal cases.[6],[7],[8],[9],[10] Morphologically, splenic marginal zone lymphomas, HCL-variant (HCLv), and other low Grade B-cell lymphoproliferative disorders are close mimickers of HCL. Cases with cytopenias and absent spleen may lead to a dubious diagnosis of aplastic anemia.[5] Additional diagnostic tools including flow cytometry have proven to be vital in such cases. The phenotype of the hairy-cell resembles that of an activated memory B-cell with aberrant expression of genes that control cell adhesion and response to cytokines. HCL is immunophenotypically characterized by bright coexpression of CD20 and CD22 along with CD103, CD11b, CD25, and CD123; the latter two being absent HCLv. Aberrant expression of other antigens such as CD2, CD5, and atypical phenotypes has been documented in the literature which can add to the diagnostic dilemmas.[11]

Recently, the identification of the disease-defining BRAF V600E mutation in hematopoietic stem cells of patients with HCL has improved the understanding of the genetic and immunological mechanisms of this leukemia. Located on the long arm of chromosome 7 (7q34), BRAF V600E is a point mutation where thymine is substituted with adenine at position 1799 on exon 15 that results in the change of amino acid from valine to glutamate. This leads to the constitutive activation of the microtubule-associated protein kinase signaling pathway conferring the neoplastic tumor cells with survival and proliferative advantage.[12] It is now believed to be the key event in the molecular pathogenesis of HCL and is detected in more than 90% cases.[12],[13],[14] Identification of this mutation in unsuspected cases of HCL is thus instrumental in confirming the diagnosis.

This study was thus undertaken to analyze the clinicopathological spectrum of this rare disorder at our center, discuss the uncommon manifestations of the disease and role of BRAFV600E mutation analysis in the diagnosis. A brief review of Indian literature was also performed to assess the Indian perspective of the disease.


 > Materials and Methods Top


This was a retrospective observational study performed in the Department of Hematology, SGPGI, Lucknow, India, over a period of past 81 months (January 2010–September 2017). The clinical and laboratory data of all the patients with a confirmed diagnosis of HCL and HCLv were collated from the electronic medical records. The study was approved by the Institutional Ethics Committee.

Morphology

Peripheral blood and bone marrow slides were reviewed to delineate the morphological spectrum of the disease.

Immunophenotyping

Flow cytometry was performed on bone marrow aspirates/peripheral blood samples collected in ethylenediaminetetraacetic acid tube. Four color (before 2013) and 6 colour flow cytometry panels were applied in all but one case in the series, which was diagnosed on bone marrow biopsy by immunohistochemistry. The monoclonal antibodies used were CD45, CD19, CD20, CD22, CD5, CD10, CD23, CD38, CD11b, CD123, CD25, CD103, FMC-7, and kappa and lambda light chains. All the antibodies were procured from Becton Dickinson Biosciences, San Jose CA, USA. Briefly, a stain lyse wash protocol was used for processing the samples. The cells were finally suspended in 0.2% paraformaldehyde and acquired on a BD FACS Canto II platform using the FACS Diva version 8.0 (Becton Dickinson, CA). Basic gating was performed on the cells with bright CD45/CD19 expression in the CD45 versus side scatter (SSC) or CD19 versus SSC dot plots.

Molecular work-up

BRAFV600E mutation screening was carried out by quantitative real-time polymerase chain reaction RT-PCR assay using SYBR-Green I chemistry on Roche Light cycler 480 system. Briefly, 100 ng of cDNA was used to amplify target sequence using SYBR Green I Master mix (Invitrogen) in a final reaction volume 20ul. The primer sets used were as following-BRAF exon15 F-5'CTCCTGTTTTCCTTTACTTACTACACCTCAGA 3', and BRAF exon15 R-5'ATCCAGACAACTGTTCAAACTGATG3'. The PCR program used was predenaturation at 95°C for 8 min, amplification cycles (45) of 95°C for 10 s, 60°C for 20 s, and 72°C for 20 s (single acquisition at this temp). Amplified DNA fragments were further analyzed for their melting temperature (Tm calling) to check the specificity of target amplified, with the Tm of specific product V600E being 78°–82°C.

Treatment

All the patients were offered treatment of a single cycle of cladribine (2-CdA) at a dose of 0.1 mg/kg/day by continuous intravenous infusion for 7 days. One of the patients received rituximab monotherapy at a dose of 375 mg/m2. Complete remission at 3 months was defined by a complete absence of hairy cells in the peripheral blood and bone marrow, normalization of peripheral-blood counts; hemoglobin: 12 g/dL, total lymphocyte count TLC- 3 × 109/L, absolute neutrophils count: 1.5 × 109/L, and platelet count of 100 × 109/L. In addition, there should be an absence of all palpable adenopathy hepatosplenomegaly and constitutional symptoms.[15]


 > Results Top


A total of 353 cases of chronic lymphoproliferative disorders were evaluated during the study period of which 16 (4.5%) cases were of HCL. These included 15 cases of classical HCL and a single case of HCL-v. There was striking male predominance with a M: F of 15:1 and a median age of 52 years (range 22–90 years). The baseline demographics of these patients are summarized in [Table 1].
Table 1: Patient demographics with detailed clinical and laboratory features

Click here to view


Clinically, weakness accompanied by pallor was the most frequent complaint seen in approximately 56% cases followed by fever in 31% cases. Abdominal discomfort was the presenting feature in 2 (12.5%) cases. Two patients presented with complaints of bleeding diathesis in the form of melena. Patient with HCL-v presented with complaints of weakness, purpural rashes, and melena. Splenomegaly and hepatomegaly were detected in 75% and 12.5% cases, respectively. Interestingly, lymphadenopathy was seen in two cases; one of these patients had an absence of splenomegaly with mediastinal lymphadenopathy, due to concomitant tuberculosis while the other patient had bilaterally enlarged axillary lymph nodes along with splenomegaly.

Complete blood counts revealed pancytopenia in 47% patients, followed by bicytopenia in 40%, and isolated anemia in 13% cases. Leukocytosis was observed in 3 (20%) cases of classical HCL and in the single case of HCL-v. Circulating hairy cells were detected in 80% (12/15) cases of classical HCL. Eight cases showed the typical morphology with circumferential cytoplasmic projections, while 3 (20%) cases showed the presence of shallow nuclear clefts, and 2 cases (13%) each showed a presence of monocytoid cells with moderate cytoplasm and conspicuous nucleoli [Figure 1]a, [Figure 1]b, [Figure 1]c, [Figure 1]d. Bone marrow was hypercellular in the majority of the cases, while two cases showed a hypocellular marrow with lymphocytosis and presence of focal lymphoid nodules on the biopsy. Interestingly, one of these cases was an unsuspected case of HCL, with hypocellular marrow with the absence of splenomegaly mimicking aplastic anemia, both clinically and morphologically.
Figure 1: Panel of May–Grunwald–Giemsa-stained photomicrographs showing, morphological variations in the hairy cells, (a) peripheral blood smear with the presence of circulating lymphoid cells with bland chromatin and hairy projections (inset), (b) cells with clumped chromatin and occasional cells with cytoplasmic projections in inset, (c) cells with abundant amount of cytoplasm, and (d) imprint smears in a case with nuclear grooves, highlighted by short arrows (100 × o.m)

Click here to view


Immunophenotypically, the cells were gated in the monocyte region in the forward scatter versus SSC plot as well as in the CD45 versus SSC plot. A bright expression of CD19/CD20/CD22 along with CD25/CD103/CD123/CD11c was noted in all the patients of classical HCL [Figure 2]. A relatively dim expression of CD25 and 103 was noted in 4 and 2 cases each, while CD123 and CD11c showed a more consistent bright positivity. Aberrant expression of CD5 and CD23 was noted in 6.7% and 31% cases, respectively; with none showing dual expression of these antigens. CD200 evaluated in 5/15 patients was strongly positive. The case of HCL – v showed bright expression of CD11c and CD103 while being negative for CD25, CD123, and CD200.
Figure 2: Flow cytometry dot plots showing, (a) cells gated in the “monocyte” region in the CD45 versus side scatter dot plot, (b-f), with bright expression of CD20, CD200, CD 25, CD11b, CD103, CD123, and heterogeneous CD23.

Click here to view


BRAFV600E mutation was present in all the four patients tested which included cases with a hypocellular marrow and absent splenomegaly. RT-PCR amplification curve and melting curves for the mutation from a representative case are depicted in [Figure 3].
Figure 3: Amplification curves for BRAFV600E mutation by SYBR green chemistry along with positive control and a negative control

Click here to view


Treatment outcome A total of eight patients opted for therapy at our center, six of which received cladribine and are alive till date, while one of the patients was managed by rituximab and the other patient died within 3 weeks of diagnosis due to septic shock, before the initiation of therapy [Figure 4]. His blood culture tested positive for an opportunistic infection by Acinetobacter baumannii . The overall survival is 87.5% among the treated patients, with a mean follow-up of 35 months (2–87 months). One of the patients was managed with rituximab monotherapy at a dose of 375 mg/m2. He had multiple comorbidities including leprosy and later on went on to develop methicillin-resistant
Figure 4: Swimmers plot depicting the course of the disease in eight patients treated at our center. Each bar represents one patient. Patient 8 expired before the initiation of therapy due to sepsis, while patient 7 is yet to achieve remission.

Click here to view


staphylococcus aureus and mononeuritis multiplex. The patient was eventually lost to follow-up. One of the patients relapsed after 6.25 years; he was readministered cladribine and is currently in remission. The remaining patients are alive and disease free with the absence of symptoms, normal blood counts, and no organomegaly. Infectious comorbidities observed in these patients included a single case each of mycobacterium tuberculosis, mycobacterium leprae, and hepatitis B infection.


 > Discussion Top


The disease HCL was first described by Bouroncle et al . as leukemic reticuloendotheliosis way back in 1958.[16] There are no Indian registries for documenting the true incidence of HCL; however, the recent literature shows a higher prevalence of 4.5%–5.3% in the Indian subcontinent[17–20] as compared to the West.[2] The higher incidence can be explained on the basis of a referral bias in these tertiary care centers, as is seen in our series. [Table 2] summarizes the patient demographics and unusual clinical/immunophenotypic variation observed in the recent Indian literature from different parts of the country. The reported median age is 50–54 years, as seen in our case series and approximately 40% of patients aged below 50 years of age, with 22 years being one of the youngest patients to be documented in Indian literature [Table 2]. Another striking observation worth mentioning is the stark predominance of the disease in males, which is reported in almost all the studies. The reasons behind this gender bias are elusive. Although it is an indolent lymphoproliferative disorder, constitutional symptoms such as fever and weight loss are a frequent association. Majority of our patients presented with weakness, pallor, and fever. Bleeding complications were observed in two patients of HCL and the single case of HCLv. The incidence of bleeding complications ranges from 15 to 20% in various studies.[17],[18] Other uncommon and rare clinical presentations include associated bone pains, cutaneous manifestations, mass lesions, neurological involvement and autoimmune phenomenon,[6],[21] none of which was seen in the present study. Splenomegaly is a prominent feature of HCL and reported in almost 90% patients historically.[22] In one of the largest study of 725 patients of HCL, compiled from 46 hematological centers over a period of 25 years, in Italy, Frassoldati et al . observed 14% patients without palpable splenomegaly.[22] However, in the recent literature, the absence of splenomegaly in HCL has been reported in almost 20%–26% cases [Table 2], as was also seen in our series of patients, possibly due to early detection of the disease. Lymphadenopathy is believed to be uncommon in HCL as the tumor cells lack CCR7 required for transendothelial migration of cell. However, lymphadenopathy has been reported in 8.5%–30% cases in various studies globally. Mercieca J observed abdominal lymphadenopathy in 28% (25/88) of their cases which correlated with long-standing and bulky disease.[23] In the current study, two of our patients had lymphadenopathy at presentation; one with bilateral axillary masses and the other with mediastinal lymphadenopathy. The presence of neutropenia, monocytopenia, and altered T-cell functions, predispose patients to the risk of infections, these complications.[21],[24] Three (20%) of our patients had concomitant infections at the time of diagnosis, which included tuberculosis, leprosy, and hepatitis B infection.
Table 2: Brief review of salient clinicopathological features observed in other recent Indian studies of hairy-cell leukemia

Click here to view


Morphologically, the majority of the cases had classical hairy cell-like features, with bland chromatin however, occasion cases with clumped chromatin, and shallow nuclear indentations were appreciated. Hypercellular marrow with a fried egg appearance on bone marrow biopsy is the hallmark of the disease. However, a small fraction of the patients may present with features of pancytopenia and a hypocellular marrow, which may create a diagnostic dilemma. A hypocellular marrow was observed in 2 (13%) cases in the current series. Shao et al . observed hypocellularity in 28% of their cases with a subtle interstitial infiltrate of the neoplastic cells. One of our middle-aged patients presented with persistent pancytopenia and absence of splenomegaly, rendering myelodysplastic syndrome, or aplastic anemia as the plausible differential diagnosis. The bone marrow was hypocellular with relative lymphocytosis. The diagnosis of HCL could only be confirmed on the basis of immunophenotyping and molecular analysis.

An HCL defining phenotype was observed in 100% of our cases, while aberrant expression of CD5 and CD23 was seen in 6% and 31% cases, respectively. None of our cases showed expression of CD10 or aberrant T-cell antigens. Shao et al .[25] performed flow cytometry in 169 patients of HCL and observed aberrant expression of various antigens like CD5(2%), CD10(12%), CD23(21%), CD38(14%), CD2(2%), CD4(0.5%), and CD13(0.5%). Similarly, Chen et al . analyzed the immunophenotypic variations in 35 patients of HCL and noted atypical phenotypes in 12 cases (34%); CD103– in 2 (6%), CD25– in 1 (3%), CD10 + in 5 (14%), and CD23+ in 6 (17%) cases.[11] None of the cases in either series or in our study showed concomitant expression of CD5 and CD23.

Identification of BRAFV600E mutation has helped us in understanding the pathogenesis of the disease. It is the key driver mutation in HCL, responsible for the cell proliferation, morphology as well as anti-apoptotic behavior of the leukemic cells.[26] It is not only diagnostic but also vital for minimal residual disease assessment. Identification of BRAFV600E mutation has also opened new avenues for developing the targeted therapy. The purine nucleoside analogs remain the treatment of choice for HCL, with durable and excellent overall response rates.[26],[27] Recently, the HCL Foundation convened an international conference to establish consensus on diagnosing, managing, and monitoring patients with HCL. They recommended that demonstration of the BRAFV600E mutation is important for all patients with HCL, particularly for those who do not respond to standard therapy or have multiple relapses. These patients would be ideal candidates for BRAFV600E inhibitors.[26]


 > Conclusion Top


HCL is an unusual B-cell lymphoproliferative disorder, which is believed to have a defined clinical and morphological presentation. However, it is important to be aware of the unusual presentations of this indolent disease, where ancillary tools such as flow cytometry and molecular profiling of the leukemic cells for BRAFV600E mutation will provide the required diagnostic accuracy.

Acknowledgment

We are grateful to Mr Manoj Kumar Sarkar for assistance in immunophenotyping and data analysis.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
 > References Top

1.
Foucar K, Falini B, Catovsky D, Stein H. Hairy cell leukemia. In: Swerdlow S, Campo E, Harris N, Jaffe E, Pileri S, Stein H, et al ., editors. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. 4th ed. Lyon, France: IARC; 2008. p. 188-90.  Back to cited text no. 1
    
2.
Ferlay J, Steliarova-Foucher E, Lortet-Tieulent J, Rosso S, Coebergh JW, Comber H, et al. Cancer incidence and mortality patterns in Europe: Estimates for 40 countries in 2012. Eur J Cancer 2013;49:1374-403.  Back to cited text no. 2
    
3.
Gamliel H, Golomb HM. Unique scanning electron microscopic features of hairy cells in hairy-cell leukemia. A review and current status. Scan Electron Microsc 1986;(Pt 4):1515-21.   Back to cited text no. 3
    
4.
Venkatesan S, Purohit A, Aggarwal M, Manivannan P, Tyagi S, Mahapatra M, et al. Unusual presentation of hairy cell leukemia: A case series of four clinically unsuspected cases. Indian J Hematol Blood Transfus 2014;30:413-7.  Back to cited text no. 4
    
5.
Rahman K, Kumari S, Singh M, Gupta R, Yadav G, Kumari N, et al . Atypical presentation of hairy cell leukemia: Significance of CD200 on flow cytometry. J Cancer Res Ther 2017. [Epub ahead of print]. Available from: http://www.cancerjournal.net/preprintarticle. asp?id=188432;type=0. [Cited on 2018 Aug 30].  Back to cited text no. 5
    
6.
Tadmor T, Polliack A. Unusual clinical manifestations, rare sites of involvement, and the association of other disorders with hairy cell leukemia. Leuk Lymphoma 2011;52 Suppl 2:57-61.  Back to cited text no. 6
    
7.
Carsuzaa F, Pierre C, Jaubert D, Viala JJ. Cutaneous findings in hairy cell leukemia. Review of 84 cases. Nouv Rev Fr Hematol 1994;35:541-3.  Back to cited text no. 7
    
8.
Colović N, Perunicić M, Jurisić V, Colović M. Specific skin lesions in hairy cell leukemia at presentation: Case report and review of literature. Med Oncol 2010;27:559-61.  Back to cited text no. 8
    
9.
Chaudhry MS, Macdonald D, Strickland N. Hairy cell leukemia presenting as a cranial mass. Am J Hematol 2011;86:423-4.  Back to cited text no. 9
    
10.
Dasanu CA, Van den Bergh M, Pepito D, Alvarez Argote J. Autoimmune disorders in patients with hairy cell leukemia: Are they more common than previously thought? Curr Med Res Opin 2015;31:17-23.  Back to cited text no. 10
    
11.
Chen YH, Tallman MS, Goolsby C, Peterson L. Immunophenotypic variations in hairy cell leukemia. Am J Clin Pathol 2006;125:251-9.  Back to cited text no. 11
    
12.
Falini B, Martelli MP, Tiacci E. BRAF V600E mutation in hairy cell leukemia: From bench to bedside. Blood 2016;128:1918-27.  Back to cited text no. 12
    
13.
Tiacci E, Trifonov V, Schiavoni G, Holmes A, Kern W, Martelli MP, et al. BRAF mutations in hairy-cell leukemia. N Engl J Med 2011;364:2305-15.  Back to cited text no. 13
    
14.
Boyd EM, Bench AJ, van 't Veer MB, Wright P, Bloxham DM, Follows GA, et al. High resolution melting analysis for detection of BRAF exon 15 mutations in hairy cell leukaemia and other lymphoid malignancies. Br J Haematol 2011;155:609-12.  Back to cited text no. 14
    
15.
Chadha P, Rademaker AW, Mendiratta P, Kim B, Evanchuk DM, Hakimian D, et al. Treatment of hairy cell leukemia with 2-chlorodeoxyadenosine (2-cdA): Long-term follow-up of the northwestern university experience. Blood 2005;106:241-6.  Back to cited text no. 15
    
16.
Bouroncle, B, Wiseman, B, Doan C. Leukemic reticuloendotheliosis. Blood. 1958;13:609-30.  Back to cited text no. 16
    
17.
Galani KS, Subramanian PG, Gadage VS, Rahman K, Ashok Kumar MS, Shinde S, et al. Clinico-pathological profile of hairy cell leukemia: Critical insights gained at a tertiary care cancer hospital. Indian J Pathol Microbiol 2012;55:61-5.  Back to cited text no. 17
  [Full text]  
18.
Konkay K, Uppin MS, Uppin SG, Raghunadha Rao D, Geetha CH, Paul TR, et al. Hairy cell leukemia: Clinicopathological and immunophenotypic study. Indian J Hematol Blood Transfus 2014;30:180-6.  Back to cited text no. 18
    
19.
Somasundaram V, Purohit A, Aggarwal M, Manivannan P, Mishra P, Seth T, et al. Hairy cell leukemia: A decade long experience of North Indian hematology center. Indian J Med Paediatr Oncol 2014;35:271-5.  Back to cited text no. 19
[PUBMED]  [Full text]  
20.
Gupta AK, Sachdeva MU, Ahluwalia J, Das R, Naseem S, Sharma P, et al. Haematological profile of 21 patients with hairy cell leukaemia in a tertiary care centre of North India. Indian J Med Res 2015;142:426-9.  Back to cited text no. 20
[PUBMED]  [Full text]  
21.
Tadmor T, Polliack A. Hairy cell leukemia: Uncommon clinical features, unusual sites of involvement and some rare associations. Best Pract Res Clin Haematol 2015;28:193-9.  Back to cited text no. 21
    
22.
Frassoldati A, Lamparelli T, Federico M, Annino L, Capnist G, Pagnucco G, et al. Hairy cell leukemia: A clinical review based on 725 cases of the Italian Cooperative Group (ICGHCL). Italian cooperative group for hairy cell leukemia. Leuk Lymphoma 1994;13:307-16.  Back to cited text no. 22
    
23.
Mercieca J, Puga M, Matutes E, Moskovic E, Salim S, Catovsky D, et al. Incidence and significance of abdominal lymphadenopathy in hairy cell leukaemia. Leuk Lymphoma 1994;14 Suppl 1:79-83.  Back to cited text no. 23
    
24.
Kraut E. Infectious complications in hairy cell leukemia. Leuk Lymphoma 2011;52 Suppl 2:50-2.  Back to cited text no. 24
    
25.
Shao H, Calvo KR, Grönborg M, Tembhare PR, Kreitman RJ, Stetler-Stevenson M, et al. Distinguishing hairy cell leukemia variant from hairy cell leukemia: Development and validation of diagnostic criteria. Leuk Res 2013;37:401-9.  Back to cited text no. 25
    
26.
Grever MR, Abdel-Wahab O, Andritsos LA, Banerji V, Barrientos J, Blachly JS, et al. Consensus guidelines for the diagnosis and management of patients with classic hairy cell leukemia. Blood 2017;129:553-60.  Back to cited text no. 26
    
27.
Robak T, Matutes E, Catovsky D, Zinzani PL, Buske C; ESMO Guidelines Committee, et al. Hairy cell leukaemia: ESMO clinical practice guidelines for diagnosis, treatment and follow-up. Ann Oncol 2015;26 Suppl 5:v100-7.  Back to cited text no. 27
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>IntroductionMaterials and Me...>Results>Discussion>Conclusion>Article Figures>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed1301    
    Printed197    
    Emailed0    
    PDF Downloaded209    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]