Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 15  |  Issue : 5  |  Page : 1067-1072

Expression of major histocompatibility complex class I polypeptide-related sequence B in adipose-derived stem cells from breast cancer patients and normal individuals


1 Shiraz Institute for Cancer Research, School of Medicine; Department of Immunology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
2 Shiraz Institute for Cancer Research, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
3 Breast Diseases Research Center, Shiraz University of Medical Sciences, Shiraz, Iran

Date of Web Publication4-Oct-2019

Correspondence Address:
Mahboobeh Razmkhah
Shiraz Institute for Cancer Research, School of Medicine, Shiraz University of Medical Sciences, PO Box: 71345-1798, Shiraz
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jcrt.JCRT_866_16

Rights and Permissions
 > Abstract 


Context: Through the expression of different immunomodulatory molecules, mesenchymal stem cells (MSCs) play a significant role in the regulation of immune responses against tumor cells. Herein, the expression of major histocompatibility complex class I polypeptide-related sequence B (MIC B) as an immunomodulatory molecule was investigated on adipose-derived stem cells (ASCs) isolated from breast cancer patients (Stage II and III) and healthy individuals.
Materials and Methods: ASCs were isolated enzymatically, and the expression of MIC B was measured using quantitative real-time polymerase chain reaction method before and after treatment with interferon γ (IFN-γ). The concentration of MIC B in the supernatant of ASCs and also sera of breast cancer and normal individuals were determined using ELISA method.
Results: The expression of MIC B in normal ASCs and Stage II ASCs was higher than Stage III ASCs. However, after treatment with IFN-γ expression of MIC B in ASCs was conversely changed as cancer ASCs showed approximately 3.5 fold higher expression of MIC B compared to normal ASCs. The mRNA expression of MIC B in Stage III, Stage II, and normal ASCs showed 61 (P = 0.02), 13 (P = 0.01) and 3 (P > 0.05) fold higher expression after stimulation with IFN-γ compared to cells with no stimulation.
Conclusion: Expression of MIC B and upregulation of this molecule in response to IFN-γ in cancer ASCs draw attention to the effective role of MSCs in the tumor microenvironment. However, more studies will be needed to further elucidate Natural-killer Group 2, member D (NKG2D) ligands-dependent immunomodulatory roles of ASCs in the tumor progression.

Keywords: Adipose-derived stem cells, breast cancer, major histocompatibility complex class I polypeptide-related sequence B, tumor microenvironment


How to cite this article:
Mansourabadi Z, Razmkhah M, Mohtasebi MS, Talei AR, Ghaderi A. Expression of major histocompatibility complex class I polypeptide-related sequence B in adipose-derived stem cells from breast cancer patients and normal individuals. J Can Res Ther 2019;15:1067-72

How to cite this URL:
Mansourabadi Z, Razmkhah M, Mohtasebi MS, Talei AR, Ghaderi A. Expression of major histocompatibility complex class I polypeptide-related sequence B in adipose-derived stem cells from breast cancer patients and normal individuals. J Can Res Ther [serial online] 2019 [cited 2019 Dec 14];15:1067-72. Available from: http://www.cancerjournal.net/text.asp?2019/15/5/1067/243498




 > Introduction Top


Mesenchymal stem cells (MSCs) are multipotent stromal cells which are described as fibroblast-like cells in many different tissues with immune regulatory capability.[1],[2] The chronic inflammatory state of tumor site leads to the recruitment of different cell types such as MSCs through the expression of chemokines.[3],[4] These cells exert their immunomodulatory effects on immune cells resulting in increasing tumor cells development and progression.[5],[6] MSCs can inhibit cytotoxic effects of T cells on cervical cancer cells through the reduction of human leukocyte antigen Class I molecules expression.[7] Secretion of soluble factors and cell-to-cell contact are involved in MSCs immunomodulation though the exact mechanism is not well identified yet.[8]

Similar to bone marrow MSCs, ASCs were also defined as important players orchestrating the tumor-promoting immune responses through the secretion of different mediators including interleukin-4 (IL-4), IL-10, and transforming growth factor β (TGF-β).[9]

Natural-killer Group 2, member D, also known as Klrk1 (NKG2D), a C-type lectin-like receptor, is expressed on natural killer (NK), CD8+ T cells, and γδ+ T cells as an activating immune receptor. NKG2D ligands are polymorphic and structural homologs of major histocompatibility complex Class I heavy chains, but not associated with β2-microglobulin and lacks CD8 binding site, also does not present any antigen. These molecules are extensively expressed in various malignancies and viral-infected tissues but are rarely expressed in normal tissues. Human NKG2D ligands include major histocompatibility complex class I polypeptide-related sequence A and B (MICA and MICB) proteins and retinoic acid early transcripts-1 (RAET1), also known as UL-16 binding proteins (ULBP). In the mouse, NKG2D ligands include five different RAET1 isoforms, three different histocompatibility 60 (H60) isoforms, and one UL-16 binding protein 1 (MULT1) gene.[10],[11],[12]

MIC B plays important roles in immunosurveillance of tumors by binding to NKG2D on immune cells such as NK and CD8+ T cells.[13] The expression of MIC B by tumor cells results also in antitumor immune responses of natural killer T cells (NKT) and gamma-delta T cells against tumor cells.[14] It has been shown that transplanted tumor cells expressing Rae1 and H60 were rejected in vivo.[15],[16] MIC B sheds by metalloproteases from tumor cells and releases to bloodstream or tissue culture medium as a soluble molecule in different malignancies.[17],[18],[19] Salih et al. have shown the presence of MIC B molecule in the sera of patients with hematopoietic or gastrointestinal malignancies.[17] It has been demonstrated that the soluble MIC B serum level is correlated with oral squamous cell carcinoma stage and patients survival.[19]

Regarding the significant role of ASCs and MIC B in the tumor development, here, we proposed for the first time to investigate the MIC B expression in ASCs isolated from breast adipose tissue of breast cancer patients before and after treatment with IFN-γ and to detect the MIC B serum level in patients with pathological Stage II and III compared to normal individuals.


 > Materials and Methods Top


Subjects

To assess the mRNA expression of MIC B, ASCs were isolated from adipose tissue of 15 breast cancer patients included eight patients with pathological Stage II and 7 with pathological Stage III. Data were compared to 8 healthy females who were undergoing cosmetic surgery and had no history of autoimmune disease or malignancy. To evaluate the serum level of MIC B, blood samples were obtained from 44 breast cancer patients, 22 with pathological Stage II and 22 with pathological Stage III and 21 age-matched healthy females. Sera were isolated after centrifugation and stored at −20°C. All samples were obtained after getting informed consent. Clinicopathological characteristic of breast cancer patients are presented in [Table 1].
Table 1: Clinicopathological characteristics of breast cancer patients

Click here to view


Adipose-derived stem cells isolation, characterization, and culture

Fragments of breast adipose tissue of breast cancer patients and normal individuals were washed with phosphate-buffered saline, minced with scissor, and digested with 0.2% collagenase I (GIBCO, USA) at 37°C for 45 min. The resulting suspension was centrifuged, and stromal cells were purified by Ficoll gradient (Biosera, UK) centrifugation, cultured in DMEM (GIBCO, USA) medium containing 10% fetal bovine serum (FBS) (GIBCO, USA) and penicillin/streptomycin (Biosera, UK). After 48 h, nonadherent cells were discarded and adherent cells were cultured. All ASCs used in this study were in fourth culture passage.

For characterization of the cells, flow cytometry analysis and differentiation were used as described previously.[9],[20] Briefly, 5 × 106 of ASCs were harvested and incubated for 30 min with phycoerythrin-conjugated mouse antihuman CD44, CD105, and CD166 (BD Biosciences, USA) and fluorescein isothiocyanate (FITC)-conjugated mouse anti-human CD14, CD34, and CD45 (BD Biosciences, USA) at room temperature (RT). Cells were stained with FITC-or PE-labeled mouse IgG as negative controls. Approximately 20,000 events were collected and further analyzed using WinMDI 2.5 software (Microsoft, Redmond, WA, USA). To show the stem cell characteristics of ASCs, they were differentiated to chondrocytes using chondrogenesis differentiation kit (STEMPRO Chondrogenesis Differentiation Kit, GIBCO, USA) and stained with 0.2% Safranin O after 2 weeks.

RNA extraction and cDNA synthesis

Total RNA was extracted from ASCs stimulated with or without 1500U/ml IFN-γ using RNX plus (Cinagene, Iran). DNase (Fermentas, Canada) treatment was performed, and then, cDNA was generated using cDNA synthesis kit (Fermentas, Canada) based on the manufacture's transcript.

Quantitative real-time polymerase chain reaction

Quantitative real-time polymerase chain reaction (qRT-PCR) method was performed using ABI step one system. Briefly, 2 μl cDNA was amplified in total volume of 20 μl containing 10 μl of 2X SYBR Green Master Mix (Fermentas, Canada), 7.4 μl DEPC-treated water and 0.3 μl of each 10 pmol forward and reverse primers. Thermal cycling was initiated with denaturation at 95°C for 10 min, followed by 50 cycles: denaturation at 95°C for 10 s, annealing, and extension at 55°C for 40 s. All data were compared to beta-actin housekeeping gene. Sequences of specific primers for qRT-PCR of MIC B (target gene) and β-actin (reference gene) were F: 5'CACCCAGGCTGCAGTTCACT3', R: 'CGGGAGTCTGAGGTACGAGAA3' and F: 5'GCCTTTGCCCATCCGC-3', R: 5'GCCGTAGCCGTTGTCG-3', respectively.

Enzyme-linked immunosorbent assay

The level of MIC B in the sera of breast cancer patients and normal individuals and the supernatant of ASCs was detected using MIC B human ELISA kit (Abcam, UK). For evaluation of supernatants, 3.5 × 104 ASCs were cultured in a volume of 400 μl DMEM containing10% FBS stimulated with 1500U/ml IFN-γ for 72 h. Then, 100 μl of standard, ASCs supernatant, and serum samples were added to the wells and incubated at 4°C for overnight and then washed 4 times. Then, 100 μl of biotinylated anti-MIC B was added to each well and washed 4 times after 1 h incubation at RT. A volume of 100 μl of streptavidin-conjugated HRP enzyme was added to each well, incubated for 45 min at RT, and then washed 4 times. After addition of 100 μl tetramethylbenzidine substrate solution, enzymatic reaction was stopped using 50 μl of stop solution, and the absorbance was measured at 450–620 nm in a microplate spectrophotometer.

Statistical analysis

The expression of MIC B mRNA was determined using 2- Δ CT method. Intergroup differences estimated using Mann–Whitney and Kruskal–Wallis H nonparametric tests and considered significant if P < 0.05. All values are expressed as the mean ± standard error of the mean (SEM) Graphs is presented using GraphPad Prism (GraphPad Software Inc., San Diego, CA).


 > Results Top


Characterization of adipose-derived stem cells

Before differentiation, ASCs were appeared with a spindle shape in culture and MSCs characteristic was demonstrated through both morphological changes and expression of chondrogenic genes postchondrogenic differentiation.[20] Flow cytometry characterization revealed that ASCs from both patients and controls were highly positive for the expressions of CD44, CD105, and CD166; however, they were negative for CD14, CD34, and CD45 expression.[9],[20]

Major histocompatibility complex class I polypeptide-related sequence B mRNA expression in cancer and normal adipose-derived stem cells before and after treatment with IFN-γ

The mRNA expression of MIC B was compared between normal, Stage II and Stage III ASCs. As it is shown in [Figure 1], the expression of MIC B in normal ASCs was approximately 2 fold higher than cancer ASCs. In addition, Stage II ASCs showed higher expression of MIC B compared to Stage III ASCs (2.5 fold). These differences were not statistically significant (P > 0.05).
Figure 1: The comparison of relative quantification of major histocompatibility complex class I polypeptide-related sequence B expression in normal, Stage II and Stage III adipose-derived stem cells with each other and before and after stimulation with IFN-γ. Data are presented as mean ± standard error of the mean. *P < 0.05

Click here to view


Relative quantification of MIC B expression in ASCs was conversely changed after stimulation with IFN-γ. As it is illustrated in [Figure 1], cancer ASCs showed approximately 3.5 fold higher expression of MIC B compared to normal ASCs after stimulation with IFN-γ. Stage III and Stage II ASCs expressed MIC B 3.6 and 3.1 fold higher than normal ASCs, respectively, after treatment the cells with IFN-γ (P > 0.05).

When we compared the mRNA expression of MIC B before and after stimulation with IFN-γ in each group of the cells, a positive trend of increase with pathological stage of breast cancer was found. Results showed 61 (P = 0.02), 13 (P = 0.01), and 3 (P > 0.05) fold higher expression of MIC B after stimulation compared to before stimulation with IFN-γ in Stage III, Stage II, and normal ASCs, respectively [Figure 1].

Major histocompatibility complex class I polypeptide-related sequence B level in adipose-derived stem cells supernatant and sera of breast cancer patients and controls

MIC B concentration in the supernatant of IFN-γ-stimulated ASCs and sera of breast cancer patients and controls are depicted in [Figure 2] and [Figure 3], respectively. Although MIC B level was higher in the supernatant of normal ASCs than cancer ASCs, this difference was not statistically significant (P > 0.05).
Figure 2: Major histocompatibility complex class I polypeptide-related sequence B concentration in the supernatant of adipose-derived stem cells stimulated with IFN-γ. Data are presented as mean ± standard error of the mean

Click here to view
Figure 3: Major histocompatibility complex class I polypeptide-related sequence B concentration in the sera of Stage II and Stage III breast cancer patients and normal individuals. Data are presented as mean ± standard error of the mean. *P < 0.05

Click here to view


MIC B concentration in the sera of normal donors was 4.5 (P = 0.01), and 6.7 (P = 0.04) fold higher than Stage II and Stage III breast cancer patients, respectively. The mean ± SEM for MIC B was 2.7 ± 1.4, 0.6 ± 0.4, and 0.4 ± 0.2 pg/ml in the sera of normal individuals, Stage II and Stage III patients, respectively. The difference in MIC B concentration between the sera of patients with pathological Stage II and III breast cancer was not statistically different (P > 0.05).

Level of major histocompatibility complex class I polypeptide-related sequence B in breast cancer patients regarding grade disease and the age of patients

The expression of MIC B in different age groups and grades of the breast cancer patients were statistically analyzed. There was no significant correlation between the expression of this molecule and grade disease and the different ages of the patients studied.


 > Discussion Top


The production of MIC B as one of the most frequently expressed human NKG2D ligands has been reported in different cancers.[18],[21] The expression of this molecule leads to the antitumor immune responses of various immune cells against tumor cells.[14] However, frequent stimulation of NKG2D receptor by its ligands results in downregulation of this receptor and the impairment of immune cells activation.[22],[23] Activated CD4+ T cells gain the ability to release NKG2D ligands and suppress CD8+ T cells function by downregulating NKG2D activating receptor.[24]

Beside tumor cells, expression of NKG2D ligands including MIC A and MIC B and ULBPs is also demonstrated in stromal cells such as BMSCs.[25] BMSCs could inhibit CD8+ T cell proliferation and cytokine production by downregulating the expression of the NKG2D receptor through the expression of MIC A/B molecules and also soluble factors such as PGE2, IDO, and TGF-β.[26] Therefore, the blocking of MIC A/B molecule on BMSCs was led to the retrieval of CD8+ T cell function.[26] It is shown by Spaggiari et al.[27] and Poggi et al.[28] that BMSCs can dampen the surface expression of NKG2D on NK cells.[27],[28] We also demonstrated in our previous study that adipose-derived MSCs significantly reduced NKG2D+ and CD69+ NK cells (Accepted by cell Journal). Herein, in accordance with others,[25],[26] we for the first time showed that adipose-derived stem cells (ASCs) can produce MIC B molecule. Based on our results, the expression of MIC B in normal ASCs was approximately 2-fold higher than cancer ASCs. In addition, Stage II ASCs showed 2.5 fold higher expression of MIC B compared to Stage III ASCs.

As it has been well identified that IFN-γ is produced by immune cells in the tumor microenvironment and plays pivotal roles in the regulation of tumor progression,[29],[30] we proposed to stimulate ASCs by IFN-γ to investigate the MIC B expression. Comparing the relative quantification of MIC B expression in normal, Stage II and Stage III ASCs before and after stimulation with IFN-γ, we showed that IFN-γ treatment changed the trend of MIC B expression in different ASCs. STAGE II and III ASCs showed higher expression of MIC B compared to normal ASCs significantly. When both stages were compared to each other, Stage III ASCs were higher producers of MIC B compared to Stage II after stimulation with IFN-γ.

On the other hand, detection of soluble form of MIC B molecule in the supernatant of ASCs stimulated with IFN-γ showed that the concentration of this molecule in the supernatant of normal ASCs was higher than that from the cancer ASCs. Regarding the present report, by increasing the expression of MIC B on their surface but not shedding of this molecule, ASCs would play crucial roles in the tumor progression. It seems that by raising the stage of breast cancer increasing the expression of MIC ligands on ASCs will occur which probably leads to the higher rate of downregulation in NKG2D on NKG2D-expressing immune cells and consequently interrupting the immunity against tumor.

Human cancer cells as a mechanism of evasion shed NKG2D ligands into the bloodstream to downregulate the expression of NKG2D on NK, NKT, γδ, and CD8+ T cells, resulting in the reduction of tumor cells susceptibility to cytotoxicity of NKG2D positive lymphocytes.[22],[23],[31],[32],[33] On the other hand, to assurance that immune cells activate only against tumor but not healthy cells, the expression of NKG2D ligands must be exactly controlled. It is shown that posttranslational regulation of the mouse NKG2D ligand, MULT1, results in MULT1 ubiquitination and degradation in healthy cells. UV stress or heat shock decreases the ubiquitination of MULT1 which leads to the augmentation of cell surface expression of this molecule.[34] In addition, it is reported that if NKG2D ligands are expressed in normal tissues, their expression is in the lowest amount which cannot activate the immune cells.[35]

Consistently, in the present study, results showed that the serum level of MIC B in healthy individuals was higher than both Stage II and III breast cancer patients. On the other words, MIC B might have more shedding to the serum in healthy individuals to guarantee that NK cells do not activate against healthy cells. There are conflicting reports because in colon adenocarcinoma, the elevated level of soluble MIC in serum was reported.[36] Also in oral squamous cell carcinoma, the increased serum level of MIC B was observed in Stage IV compared to normal individuals which was associated with decreased survival rate in the patients.[19] A possible explanation for this discrepancy could be the type of cancer and may be best explained by differences in the tumor growth pattern.


 > Conclusion Top


The MIC A/B expression by ASCs may represent one of the crucial mechanisms whereby ASC modulate immune cell function in the tumor microenvironment. This prediction will undoubtedly require further relevant studies for more confirmation. Investigating the expression of other ligands of NKG2D by ASCs seems to be beneficial to identify NKG2D ligands-dependent immunomodulatory roles of ASCs in the tumor microenvironment.

Acknowledgments

Hereby, the authors would like to thank patients and all participants for their kind contribution in this project.

Financial support and sponsorship

This study was financially supported by Shiraz University of Medical Sciences, Shiraz, Iran (Grant no. 93-7222) and Shiraz Institute for Cancer Research (ICR-100-504). This research was extracted from M. Sc. thesis of Zahra Mansourabadi for fulfilling her M. Sc. degree.

Conflicts of interest

There are no conflicts of interest.



 
 > References Top

1.
Garcia-Olmo D, Herreros D, Pascual I, Pascual JA, Del-Valle E, Zorrilla J, et al. Expanded adipose-derived stem cells for the treatment of complex perianal fistula: A phase II clinical trial. Dis Colon Rectum 2009;52:79-86.  Back to cited text no. 1
    
2.
Gebler A, Zabel O, Seliger B. The immunomodulatory capacity of mesenchymal stem cells. Trends Mol Med 2012;18:128-34.  Back to cited text no. 2
    
3.
Ridge SM, Sullivan FJ, Glynn SA. Mesenchymal stem cells: Key players in cancer progression. Mol Cancer 2017;16:31.  Back to cited text no. 3
    
4.
Lazennec G, Lam PY. Recent discoveries concerning the tumor - mesenchymal stem cell interactions. Biochim Biophys Acta 2016;1866:290-9.  Back to cited text no. 4
    
5.
Djouad F, Plence P, Bony C, Tropel P, Apparailly F, Sany J, et al. Immunosuppressive effect of mesenchymal stem cells favors tumor growth in allogeneic animals. Blood 2003;102:3837-44.  Back to cited text no. 5
    
6.
Guan J, Chen J. Mesenchymal stem cells in the tumor microenvironment. Biomed Rep 2013;1:517-21.  Back to cited text no. 6
    
7.
McLean K, Gong Y, Choi Y, Deng N, Yang K, Bai S, et al. Human ovarian carcinoma–Associated mesenchymal stem cells regulate cancer stem cells and tumorigenesis via altered BMP production. J Clin Invest 2011;121:3206-19.  Back to cited text no. 7
    
8.
Abumaree M, Al Jumah M, Pace RA, Kalionis B. Immunosuppressive properties of mesenchymal stem cells. Stem Cell Rev 2012;8:375-92.  Back to cited text no. 8
    
9.
Razmkhah M, Jaberipour M, Erfani N, Habibagahi M, Talei AR, Ghaderi A, et al. Adipose derived stem cells (ASCs) isolated from breast cancer tissue express IL-4, IL-10 and TGF-β1 and upregulate expression of regulatory molecules on T cells: Do they protect breast cancer cells from the immune response? Cell Immunol 2011;266:116-22.  Back to cited text no. 9
    
10.
Stephens HA. MICA and MICB genes: Can the enigma of their polymorphism be resolved? Trends Immunol 2001;22:378-85.  Back to cited text no. 10
    
11.
Xu X, Rao GS, Groh V, Spies T, Gattuso P, Kaufman HL, et al. Major histocompatibility complex class I-related chain A/B (MICA/B) expression in tumor tissue and serum of pancreatic cancer: Role of uric acid accumulation in gemcitabine-induced MICA/B expression. BMC Cancer 2011;11:194.  Back to cited text no. 11
    
12.
Zhang J, Basher F, Wu JD. NKG2D ligands in tumor immunity: Two sides of a coin. Front Immunol 2015;6:97.  Back to cited text no. 12
    
13.
Groh V, Rhinehart R, Randolph-Habecker J, Topp MS, Riddell SR, Spies T, et al. Costimulation of CD8alphabeta T cells by NKG2D via engagement by MIC induced on virus-infected cells. Nat Immunol 2001;2:255-60.  Back to cited text no. 13
    
14.
Nausch N, Cerwenka A. NKG2D ligands in tumor immunity. Oncogene 2008;27:5944-58.  Back to cited text no. 14
    
15.
Cerwenka A, Baron JL, Lanier LL. Ectopic expression of retinoic acid early inducible-1 gene (RAE-1) permits natural killer cell-mediated rejection of a MHC class I-bearing tumor in vivo. Proc Natl Acad Sci U S A 2001;98:11521-6.  Back to cited text no. 15
    
16.
Diefenbach A, Jensen ER, Jamieson AM, Raulet DH. Rae1 and H60 ligands of the NKG2D receptor stimulate tumour immunity. Nature 2001;413:165-71.  Back to cited text no. 16
    
17.
Salih HR, Goehlsdorf D, Steinle A. Release of MICB molecules by tumor cells: Mechanism and soluble MICB in sera of cancer patients. Hum Immunol 2006;67:188-95.  Back to cited text no. 17
    
18.
Holdenrieder S, Stieber P, Peterfi A, Nagel D, Steinle A, Salih HR, et al. Soluble MICB in malignant diseases: Analysis of diagnostic significance and correlation with soluble MICA. Cancer Immunol Immunother 2006;55:1584-9.  Back to cited text no. 18
    
19.
Tamaki S, Kawakami M, Ishitani A, Kawashima W, Kasuda S, Yamanaka Y, et al. Soluble MICB serum levels correlate with disease stage and survival rate in patients with oral squamous cell carcinoma. Anticancer Res 2010;30:4097-101.  Back to cited text no. 19
    
20.
Razmkhah M, Jaberipour M, Hosseini A, Safaei A, Khalatbari B, Ghaderi A, et al. Expression profile of IL-8 and growth factors in breast cancer cells and adipose-derived stem cells (ASCs) isolated from breast carcinoma. Cell Immunol 2010;265:80-5.  Back to cited text no. 20
    
21.
Liu G, Lu S, Wang X, Page ST, Higano CS, Plymate SR, et al. Perturbation of NK cell peripheral homeostasis accelerates prostate carcinoma metastasis. J Clin Invest 2013;123:4410-22.  Back to cited text no. 21
    
22.
Groh V, Wu J, Yee C, Spies T. Tumour-derived soluble MIC ligands impair expression of NKG2D and T-cell activation. Nature 2002;419:734-8.  Back to cited text no. 22
    
23.
Ashiru O, Boutet P, Fernández-Messina L, Agüera-González S, Skepper JN, Valés-Gómez M, et al. Natural killer cell cytotoxicity is suppressed by exposure to the human NKG2D ligand MICA*008 that is shed by tumor cells in exosomes. Cancer Res 2010;70:481-9.  Back to cited text no. 23
    
24.
Cerboni C, Ardolino M, Santoni A, Zingoni A. Detuning CD8+T lymphocytes by down-regulation of the activating receptor NKG2D: Role of NKG2D ligands released by activated T cells. Blood 2009;113:2955-64.  Back to cited text no. 24
    
25.
Spaggiari GM, Capobianco A, Becchetti S, Mingari MC, Moretta L. Mesenchymal stem cell-natural killer cell interactions: Evidence that activated NK cells are capable of killing MSCs, whereas MSCs can inhibit IL-2-induced NK-cell proliferation. Blood 2006;107:1484-90.  Back to cited text no. 25
    
26.
Li M, Sun X, Kuang X, Liao Y, Li H, Luo D, et al. Mesenchymal stem cells suppress CD8+ T cell-mediated activation by suppressing natural killer group 2, member D protein receptor expression and secretion of prostaglandin E2, indoleamine 2, 3-dioxygenase and transforming growth factor-β. Clin Exp Immunol 2014;178:516-24.  Back to cited text no. 26
    
27.
Spaggiari GM, Capobianco A, Abdelrazik H, Becchetti F, Mingari MC, Moretta L, et al. Mesenchymal stem cells inhibit natural killer-cell proliferation, cytotoxicity, and cytokine production: Role of indoleamine 2,3-dioxygenase and prostaglandin E2. Blood 2008;111:1327-33.  Back to cited text no. 27
    
28.
Poggi A, Prevosto C, Massaro AM, Negrini S, Urbani S, Pierri I, et al. Interaction between human NK cells and bone marrow stromal cells induces NK cell triggering: Role of NKp30 and NKG2D receptors. J Immunol 2005;175:6352-60.  Back to cited text no. 28
    
29.
Ikeda H, Old LJ, Schreiber RD. The roles of IFN gamma in protection against tumor development and cancer immunoediting. Cytokine Growth Factor Rev 2002;13:95-109.  Back to cited text no. 29
    
30.
García-Tuñón I, Ricote M, Ruiz A A, Fraile B, Paniagua R, Royuela M, et al. Influence of IFN-gamma and its receptors in human breast cancer. BMC Cancer 2007;7:158.  Back to cited text no. 30
    
31.
Wu JD, Higgins LM, Steinle A, Cosman D, Haugk K, Plymate SR, et al. Prevalent expression of the immunostimulatory MHC class I chain-related molecule is counteracted by shedding in prostate cancer. J Clin Invest 2004;114:560-8.  Back to cited text no. 31
    
32.
Song H, Kim J, Cosman D, Choi I. Soluble ULBP suppresses natural killer cell activity via down-regulating NKG2D expression. Cell Immunol 2006;239:22-30.  Back to cited text no. 32
    
33.
Salih HR, Holdenrieder S, Steinle A. Soluble NKG2D ligands: Prevalence, release, and functional impact. Front Biosci 2008;13:3448-56.  Back to cited text no. 33
    
34.
Cerwenka A. New twist on the regulation of NKG2D ligand expression. J Exp Med 2009;206:265-8.  Back to cited text no. 34
    
35.
Champsaur M, Lanier LL. Effect of NKG2D ligand expression on host immune responses. Immunol Rev 2010;235:267-85.  Back to cited text no. 35
    
36.
Doubrovina ES, Doubrovin MM, Vider E, Sisson RB, O'Reilly RJ, Dupont B, et al. Evasion from NK cell immunity by MHC class I chain-related molecules expressing colon adenocarcinoma. J Immunol 2003;171:6891-9.  Back to cited text no. 36
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>IntroductionMaterials and Me...>Results>Discussion>Conclusion>Article Figures>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed637    
    Printed25    
    Emailed0    
    PDF Downloaded28    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]