Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 15  |  Issue : 3  |  Page : 571-575

Detection of human papillomavirus 16 and 18 in patients with oral squamous cell carcinoma and potentially malignant oral disorders in South Indian population: A pilot study


1 Department of Oral Pathology, Karpaga Vinayaka Institute of Dental Sciences, Kancheepuram, Tamil Nadu, India
2 Department of Oral Pathology, SRM Dental College, Chennai, Tamil Nadu, India

Date of Web Publication29-May-2019

Correspondence Address:
Dr. Karthika Panneerselvam
Karpaga Vinayaga Institute of Dental Sciences, GST Road, Chinna Kolambakkam, Palayanoor PO, Madurantagam Taluk, Kancheepuram - 603 308, Tamilnadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jcrt.JCRT_1012_17

Rights and Permissions
 > Abstract 

The Aim of the Study: Human papillomavirus (HPV) is an oncogenic virus and the high-risk genotype HPV 16 and 18 are the most commonly associated with carcinoma. The aim of the study is to determine the prevalence of HPV 16 and 18 in normal oral mucosa, potentially malignant oral disorders (PMOD), and in oral squamous cell carcinoma (OSCC) in South Indian population and whether it can be used as a biological marker to identify the severity of the disease in patients.
Materials and Methods: Cytological samples from buccal mucosa were obtained from ten OSCC patients, ten patients with PMOD, and ten from control group. The samples were subjected to polymerase chain reaction.
Results: The prevalence of HPV 16 in control, PMOD, and OSCC was 80%, 50%, and 70%, respectively. The prevalence of HPV 18 in control, PMOD, and OSCC was 70%, 60%, and 50%, respectively.
Conclusion: HPV 16 and 18 was noticed in normal oral mucosa, potentially malignant oral lesions, and SCC. The absence of sequential increase or decrease of HPV 16 and 18 in the three groups in this study prevents its use from being used as a marker to identify the progression of the disease.

Keywords: Exfoliated cells, human papillomavirus 16 and 18, oral squamous cell carcinoma, polymerase chain reaction analysis, potentially malignant oral disorders


How to cite this article:
Panneerselvam K, Rameshkumar A, Rajkumar K, Ramadoss R. Detection of human papillomavirus 16 and 18 in patients with oral squamous cell carcinoma and potentially malignant oral disorders in South Indian population: A pilot study. J Can Res Ther 2019;15:571-5

How to cite this URL:
Panneerselvam K, Rameshkumar A, Rajkumar K, Ramadoss R. Detection of human papillomavirus 16 and 18 in patients with oral squamous cell carcinoma and potentially malignant oral disorders in South Indian population: A pilot study. J Can Res Ther [serial online] 2019 [cited 2019 Nov 16];15:571-5. Available from: http://www.cancerjournal.net/text.asp?2019/15/3/571/251617




 > Introduction Top


Oral squamous cell carcinoma (OSCC) is the predominant malignant tumor of the oral cavity. OSCC is fatal, and there has been an eminent increase in its incidence universally.[1] In majority of the cases, potentially malignant disorders such as oral lichen planus, leukoplakia, and oral submucous fibrosis are known to pave the way for OSCC.[2],[3] Although tobacco, alcohol, and betel nut have been identified and studied as the most common etiological factors, viruses such as human papillomavirus (HPV) are also known to play a substantial role in the etiopathogenesis of SCC.[4] HPV belongs to Papillomaviridae family and measures around 55 nm in diameter with 7200–8000 base pairs.[2] HPV infection is transmitted by sexual contact, vertical spread, or by autoinoculation. In the epithelium, HPV attaches to the basal cell layer. The specific or precise site of attachment is facilitated by heparin sulfate. Once inside the mucosa, the virus can be latent or cause subclinical or clinical infection.[5] In HPV-associated cytopositive SCC, oncogenic proteins E6/E7 regulate carcinogenesis [6] by disturbing p53 and Rb in the cell cycle pathway.[7]

The frequency of HPV virus in carcinoma and potentially malignant cases ranges from 0% to 100% in the various studies done before. The difference in frequencies in the studies has been attributed to the type of samples collected, methodology used to study the samples, and the patient group that is selected.[8],[9] Hence, part of HPVs role in potentially malignant oral disorder (PMOD) and OSCC remains obscure.[8] Very few studies have been recorded in India. The focus of this study is to identify the prevalence of HPV 16 and 18 in OSCC, PMOD, and normal mucosa in the south Indian population and to analyze its use as a biomarker in malignancy.


 > Materials and Methods Top


Approval to conduct the study was obtained from the Institutional Review Board and the Ethical Committee. Complete case histories including patients' age, sex, habits, questionnaires, and verbal and written consent were obtained from all patients enrolled in the study. The study involved samples from ten OSCC patients (Group I), ten PMOD patients (Group II), and ten from controls (Group III). Samples from patients of all the Group II and III were obtained after confirmation by histopathological report.

Exfoliated cells were selected as the source of sample collection. The sampling technique selected for this study was the removal of exfoliated cells with cytobrush. Patients were asked to rinse the mouth thoroughly with water before the procedure. The samples were taken by gentle scraping on the lesional site. Each site was scraped for 4–5 times. Care was taken to avoid cross-contamination. The tip of the cytobrush was then immersed in 1 ml of phosphate buffer saline solution pH and was subsequently frozen at −80°C. Exfoliated cells collected from the OSCC, potentially malignant disorder, and control patients were given identifications code from 1 to 30. All the samples were blinded to avoid bias. Spin column protocol – Qiagen DNeasy Blood and Tissue Kit was used to isolate genomic DNA from tissue sample. Cytological scrapes were centrifuged at 3000 rpm for 5 min, followed by removal of the supernatant. The sterile TE buffer (10 mM Tris pH 8.3 and 1 mM ethylenediaminetetraacetic acid [EDTA]) was used to wash the pellet. Subsequently, the pellet was dissolved in 150 μl of 10 mM Tris pH 8.3, 0.45% Tween 20; 0.45% Nonidet P – 40, and 200 μg/ml of Proteinase k and incubated at 55°C for 1 h for cytological scrapes. For 15 min, Proteinase k was deactivated at 95°C. Further purification of DNA was done by phenol/chloroform extraction and precipitated with ethanol and NaCl. The purified DNA was dissolved in 50 μl of TE buffer and was stored at −20°C. Polymerase chain reaction (PCR) analysis was done for the samples. The reaction conditions included 5 min at 95°Cfor initial denaturation, 35 cycles of denaturation (30 s at 95°C), annealing (30 s at 55°C), and extension (30 s at 72°C) and 5 min for final extension in 20 μl of PCR reaction mixture. The reaction mixture consists of 50 ng of DNA isolated from tissue, 10 P Mole of each oligonucleotide primer, and the reaction product was checked using agarose gel.

Primer sequence for HPV 16 and 18 was:

HPV 16 E6: Forward primer: GAACCGGTTAGTATAAAAGCAGAC

HPV 16 E6 Reverse primer: AGCTGGGTTTCTCTACGTGTTCT

HPV 18 E7 Forward primer: CTATAGAGGCCAGTGCCATT

HPV 18 E7 Reverse primer: TCTGGCTTCACACTTACAACA.

Quantity of materials used in PCR are (1) Forward primer - 2microlitre, (2) Reverse primer - 2microlitre, (3) Taq DNA pol Master mix (2x) - 10microlitre and (4)DNAse/RNAse free water and DNA - 6microlitre.

For agarose gel electrophoresis, 1 g of agarose was weighed out into flask and 100 ml of 1X Tris - acetate - EDTA (TAE) buffer was added. The solution was boiled to dissolve the agarose and the solution was cooled down to about 60°C. Two microliters of ethidium bromide was added to the solution and poured into the gel tray. The tray was allowed to cool for 15–30 min at room temperature. After the gel cooled down and turned solid, the gel was placed on to the tank with 1X TAE buffer. The PCR product was loaded on to the gel and run at 100 volts. Finally, the result was viewed under ultraviolet illuminator.


 > Results Top


The mean age of Group I patient was 56.4, Group II was 36.4, and Group III was 47.4. The study included 27 male and 3 female patients. All patients were married. The habits of the patients were collected individually. The tobacco users in the normal group were 2 (20%) and alcoholic 1 (10%); in PMOD group, the tobacco users were 9 (90%) and alcoholic 4 (40%); and in carcinoma group, the tobacco users were 10 (100%) and alcoholic 4 (40%). The tobacco users in the study involved both smokers and chewers [Table 1]. The histologic type of majority of the carcinoma patients was moderately differentiated SCC (60%). Well-differentiated and poorly differentiated SCC was 30% and 10%, respectively. The carcinoma samples were obtained from the buccal mucosa (30%), alveolar mucosa (30%), floor of the mouth (10%), palate (10%), lateral border of the tongue (10%), and the tuberosity (10%). In PMOD group, it included 50% leukoplakia, 10% lichen planus, and 40% oral submucous fibrosis.
Table 1: Demographic details and human papillomavirus detection

Click here to view


The study evaluated thirty samples. In the gel electrophoresis of PCR product of HPV 16, lane 2, 4, 6, 7, 13, 17, 20, 27, 28, and 30 were negative. In the gel electrophoresis of PCR product of HPV 18, lane 2, 4, 6, 7, 13, 14, 17, 20, 22, 24, 28, and 30 were negative. HPV 16 was detected in 20/30 cases, while HPV 18 was detected in 18/30 cases in 21/30 cases HPV 16 or 18 was positive. In 17/30 cases, HPV 16 and 18 was positive. In normal group, HPV 16 and 18 were seen in 8/10 cases and 7/10 cases, respectively. IN PMOD group, HPV 16 and 18 were seen in 5/10 cases and 6/10 cases, respectively. In carcinoma group, HPV 16 and 18 were seen in 7/10 cases and 5/10 cases, respectively. The statistical analysis of the data was obtained using SPSS software (Version 16) (Chicago, SPSS Inc.). Chi-square test was used for the comparison. Comparison of P values between the groups was insignificant [Table 2] and [Table 3].
Table 2: Comparison of P values among the groups for human papillomavirus 16

Click here to view
Table 3: Comparison of P values among the groups for human papillomavirus 18

Click here to view



 > Discussion Top


The various studies conducted earlier have demonstrated diversity in HPV prevalence rate due to variations in demographic change,[10] samples selected, and the study technique.[8] Less number of studies have been documented in India associating HPV with oncogenesis. In a study by Balaram et al., HPV 18 was detected in 47% of cases and HPV 16 in 42% of cases.[11] However, in a study by D'Costa et al. in a group of people of Indian descent, HPV 16 was identified in OSCC and PMOD, but HPV 18 was not identified even in one of the same samples.[12] Since the results are varied, our study was conducted to detect HPV prevalence in South Indian population.

Samples that were commonly used in the previous studies involved biopsied sections and cytological scrapes.[8] SahebJamee et al. evaluated the presence of HPV even in saliva rinses of OSCC patients. HPV was observed in 40.9% of OSCC samples and 25% of the control samples though the results were not statistically significant.[13] Cytological samples were used to study HPV presence in this study. The type of the technique that is selected to study the sample is also known to affect the outcome of the study.[8] The techniques that are employed for the detection of HPV includes in situ hybridization, immunohistochemistry, Southern blotting, Hybrid Capture II, DNA Microarrays, and PCR.[14] It has been documented that PCR is a remarkably sensitive detection method.[14] Therefore, in this study, cytological samples obtained from buccal mucosa were subjected to PCR to study the prevalence of HPV.

A study done by Premoli-De-Percoco et al. with OSCC patients alone, revealed HPV positivity in 60%.[15] Contrary to this, study done by Elena Riet Correa stated that, of the 40 OSCC samples that were taken, HPV was not present even in one sample. The study concluded that HPV virus does not always play a role in carcinogenesis.[16] The difference in the incidence of HPV in the carcinoma samples of the previous studies was attributed to the difference in the techniques and population studied.[16]

In our study, the prevalence of HPV in carcinoma samples and PMOD was confirmed. HPV 16 was seen in 70% of OSCC cases and HPV 18 was seen in 50% of OSCC. In PMOD group, the prevalence of HPV 16 and 18 was 50% and 60%. This affirms the prevalence of HPV in the South Indian population and the probability that it could play a role in carcinogenesis.

Several HPV genotypes have been isolated from oral lesions. However, in OSCC, the most commonly detected HPV genotypes are 16, 18, 31, and 33.[1] HPV 16 was found in 63.5% of the OSCC, while HPV 18 was seen only in 30.8% in a study done by Zhao et al.[17] Similar to that study, our data indicated an increased prevalence of HPV 16 in OSCC than HPV 18. In the study done by Ha et al., HPV 16 DNA was detected in 0.98% of premalignant lesions and in 2.9% of malignant lesions.[18] In this study, prevalence of HPV 16 was 50% and 70% in PMOD and OSCC, respectively.

HPV detection in normal mucosa has been studied earlier and was contradicting. Six hundred and sixty-two samples were investigated and follow-up survey was done by Kurose et al. for HPV 16, 53, 71, and 12. Detection of HPV DNA in four samples confirmed its presence in normal oral mucosa. The study concluded that oral HPV infection in normal oral mucosa is uncommon in that population and HPV 16 and HPV 53 are not persistent in normal oral mucosa.[19] A study done by Terai et al. for HPV infection in normal oral cavity detected HPV 18 in 86.7% and HPV 16 in 6.7% samples and stated that HPV infection is common in oral cavity. Other genotypes were also detected in the study.[20] The prevalence of HPV 16 and 18 was identified even in the normal mucosal samples in the study. This offers definitive proof of the presence of HPV even in normal mucosa in this population.

We also observed in the study that HPV prevalence was detected the highest in the normal group than the other two groups. The prevalence of HPV 16 in normal, PMOD, and OSCC was 80%, 50%, and 70%, respectively. The prevalence of HPV 18 in normal, PMOD, and OSCC was 70%, 60%, and 50%, respectively, showing a gradual decrease [Figure 1]. Contrary to this study, in a meta-analysis of HPV as a risk factor for OSCC by Miller and Johnstone, HPV was detected in 10% of normal mucosa. In the same study, HPV was detected in 22.2% of leukoplakia, 26.2% of intraepithelial neoplasia, 29.5% of verrucous carcinoma, and 46.5% of OSCC. The study stated that the possibility of detecting HPV in oral carcinoma was 4.7 times more than in normal oral mucosa.[21] The study revealed a sequential increase in the detection of HPV from normal to PMOD to carcinoma, unlike our study.
Figure 1: Prevalence of human papillomavirus 16 and human papillomavirus 18 in comparison with different groups

Click here to view


The prevalence of HPV in normal mucosa was attributed to existence of the virus in latent and/or subclinical form.[10],[22] HPVs tendency to remain in the latent form in the body without progressing to malignancy arises when the immune response to the virus is not high or when the genome integration is absent.[10] The prevalence of HPV 16 and 18 in normal group in this study also signifies that, in this particular population, there is increased probability of HPV existence in oral cavity in the subclinical or the latent form. Furthermore, the decreased prevalence of HPV in SCC of both the groups can be attributed to the hypothesis of hit and run.[12],[23]

According to this hypothesis, viruses can bring about transformation in the cell in the initial stage or with the initial hit.[12],[24] HPV 16 may inactivate p53 allowing cellular proliferation with loss of episomal forms in due course. Repeated hits, in association with carcinogens like tobacco, could result in conversion of potentially malignant condition to malignancy in a subgroup of cancer.[12] A study by Iwasaka et al. has also suggested hit and run hypothesis for HPV 18.[25] Therefore, the viruses that are active in the initial stage and may later disappear inducing carcinogenesis.[12],[24]

In this study, the increase in the prevalence of HPV 16 and 18 in normal group and decreased prevalence of HPV 16 in PMOD precludes the use of HPV virus as a biological marker to identify the disease progression. To enable its use as a marker, the prevalence of virus should have changed sequentially from normal to SCC group.

However, as the previous studies have supported the etiological role of HPV in at least a group of oral cancers as by González et al.[23] and its progressive increase in detection from nonmalignant, potentially malignant to malignant lesions,[4] if the virus is detected in normal mucosa as in this study, it is indicated that the patients are carefully monitored.

The association of HPV and carcinogenesis with habits in the various studies done before is very contradicting.[10] Study by Schwartz et al. favored significant relation between HPV and smokers contrary to the study by Smith et al. and Lo Muzio et al. The decreased presence of HPV-associated tumors in smokers was correlated with the possibility that smoking increases keratinization which prevents the virus entry into the basal layer.[9] In this study, increased prevalence of HPV was noticed both in normal group and carcinoma group.

As co-existence of external factors like smoking and alcohol can credit to HPV's carcinogenic ability,[9] HPV positive patients with habits should be monitored regularly for the occurrence of potentially malignant and malignant lesions.

Interestingly, detection of HPV in the cytological scrapes obtained from the buccal mucosa in this study proves that buccal mucosa is a good reservoir for the virus. It also permits the possibility that cytological scrapes can be considered as samples for easy and fast procuring method in prevention and survey programs for HPV.

Although the smaller sample size is a limitation of the study, prevalence of HPV 16 and 18 has been proved in this population. According to this study, increased prevalence of HPV in normal and in some potentially malignant cases prevents its use from being used as a marker to identify the progression of malignancy.


 > Conclusion Top


Prevalence of HPV 16 and 18 was observed in OSCC, PMOD, and control group in South Indian population. Study involving increased sample size without habits and use of advanced molecular detection techniques will give us a better idea on the sole role of HPV in carcinogenesis from its initial stage and thereby its use as a biomarker.

Acknowledgment

The authors would like to acknowledge Government Arignar Anna Memorial Cancer Hospital, Karapettai, Kancheepuram, for providing samples for the study.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
 > References Top

1.
Montaldo C, Mastinu A, Zorco S, Santini N, Pisano E, Piras V, et al. Distribution of human papillomavirus genotypes in Sardinian patients with oral squamous cell carcinoma. Open Virol J 2010;4:163-8.  Back to cited text no. 1
    
2.
Chaudhary AK, Pandya S, Mehrotra R, Bharti AC, Singh M, Singh M, et al. Comparative study between the hybrid capture II test and PCR based assay for the detection of human papillomavirus DNA in oral submucous fibrosis and oral squamous cell carcinoma. Virol J 2010;7:253.  Back to cited text no. 2
    
3.
Yardimci G, Kutlubay Z, Engin B, Tuzun Y. Precancerous lesions of oral mucosa. World J Clin Cases 2014;2:866-72.  Back to cited text no. 3
    
4.
Zarei MR, Moradie A, Hamkar R, Mohammadalizadeh S, Chamani G, Alizadeh N, et al. Detection of human papilloma virus DNA sequences in oral leions using polymerase chain reaction. Acta Med Iran 2007;45:177-82.  Back to cited text no. 4
    
5.
Feller L, Khammissa RA, Wood NH, Lemmer J. Epithelial maturation and molecular biology of oral HPV. Infect Agent Cancer 2009;4:16.  Back to cited text no. 5
    
6.
Feller L, Wood NH, Khammissa RA, Lemmer J. Human papillomavirus-mediated carcinogenesis and HPV-associated oral and oropharyngeal squamous cell carcinoma. Part 2: Human papillomavirus associated oral and oropharyngeal squamous cell carcinoma. Head Face Med 2010;6:15.  Back to cited text no. 6
    
7.
Tang X, Jia L, Ouyang J, Takagi M. Comparative study of HPV prevalence in Japanese and North-East Chinese oral carcinoma. J Oral Pathol Med 2003;32:393-8.  Back to cited text no. 7
    
8.
Giovannelli L, Campisi G, Lama A, Giambalvo O, Osborn J, Margiotta V, et al. Human papillomavirus DNA in oral mucosal lesions. J Infect Dis 2002;185:833-6.  Back to cited text no. 8
    
9.
Campisi G, Panzarella V, Giuliani M, Lajolo C, Di Fede O, Falaschini S, et al. Human papillomavirus: Its identikit and controversial role in oral oncogenesis, premalignant and malignant lesions (review). Int J Oncol 2007;30:813-23.  Back to cited text no. 9
    
10.
Dhanapal R, Ranganathan K, Kondaiah P, Devi RU, Joshua E, Saraswathi TR, et al. High-risk human papilloma virus in archival tissues of oral pathosis and normal oral mucosa. Contemp Clin Dent 2015;6:148-52.  Back to cited text no. 10
[PUBMED]  [Full text]  
11.
Balaram P, Nalinakumari KR, Abraham E, Balan A, Hareendran NK, Bernard HU, et al. Human papillomaviruses in 91 oral cancers from Indian betel quid chewers – high prevalence and multiplicity of infections. Int J Cancer 1995;61:450-4.  Back to cited text no. 11
    
12.
D'Costa J, Saranath D, Dedhia P, Sanghvi V, Mehta AR. Detection of HPV-16 genome in human oral cancers and potentially malignant lesions from India. Oral Oncol 1998;34:413-20.  Back to cited text no. 12
    
13.
SahebJamee M, Boorghani M, Ghaffari SR, AtarbashiMoghadam F, Keyhani A. Human papillomavirus in saliva of patients with oral squamous cell carcinoma. Med Oral Patol Oral Cir Bucal 2009;14:e525-8.  Back to cited text no. 13
    
14.
Chaudhary AK, Singh M, Sundaram S, Mehrotra R. Role of human papillomavirus and its detection in potentially malignant and malignant head and neck lesions: Updated review. Head Neck Oncol 2009;1:22.  Back to cited text no. 14
    
15.
Premoli-De-Percoco G, Ramirez JL. High risk human papillomavirus in oral squamous carcinoma: Evidence of risk factors in a Venezuelan rural population. Preliminary report. J Oral Pathol Med 2001;30:355-61.  Back to cited text no. 15
    
16.
Rivero ER, Nunes FD. HPV in oral squamous cell carcinomas of a Brazilian population: Amplification by PCR. Braz Oral Res 2006;20:21-4.  Back to cited text no. 16
    
17.
Zhao D, Xu QG, Chen XM, Fan MW. Human papillomavirus as an independent predictor in oral squamous cell cancer. Int J Oral Sci 2009;1:119-25.  Back to cited text no. 17
    
18.
Ha PK, Pai SI, Westra WH, Gillison ML, Tong BC, Sidransky D, et al. Real-time quantitative PCR demonstrates low prevalence of human papillomavirus type 16 in premalignant and malignant lesions of the oral cavity. Clin Cancer Res 2002;8:1203-9.  Back to cited text no. 18
    
19.
Kurose K, Terai M, Soedarsono N, Rabello D, Nakajima Y, Burk RD, et al. Low prevalence of HPV infection and its natural history in normal oral mucosa among volunteers on Miyako Island, Japan. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;98:91-6.  Back to cited text no. 19
    
20.
Terai M, Hashimoto K, Yoda K, Sata T. High prevalence of human papillomaviruses in the normal oral cavity of adults. Oral Microbiol Immunol 1999;14:201-5.  Back to cited text no. 20
    
21.
Miller CS, Johnstone BM. Human papillomavirus as a risk factor for oral squamous cell carcinoma: A meta-analysis, 1982-1997. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2001;91:622-35.  Back to cited text no. 21
    
22.
Galvao Castro TP, Filho IB. Prevalence of human papilloma virus (HPV) in oral cavity and oropharynx. Rev Bras Otorrinolaringol 2006;72:272-82.  Back to cited text no. 22
    
23.
González JV, Gutiérrez RA, Keszler A, Colacino Mdel C, Alonio LV, Teyssie AR, et al. Human papillomavirus in oral lesions. Medicina (B Aires) 2007;67:363-8.  Back to cited text no. 23
    
24.
Nevels M, Täuber B, Spruss T, Wolf H, Dobner T. “Hit-and-run” transformation by adenovirus oncogenes. J Virol 2001;75:3089-94.  Back to cited text no. 24
    
25.
Iwasaka T, Hayashi Y, Yokoyama M, Hara K, Matsuo N, Sugimori H, et al. 'Hit and run' oncogenesis by human papillomavirus type 18 DNA. Acta Obstet Gynecol Scand 1992;71:219-23.  Back to cited text no. 25
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Conclusion>Article Figures>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed908    
    Printed17    
    Emailed0    
    PDF Downloaded86    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]