Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
ORIGINAL ARTICLE
Year : 2018  |  Volume : 14  |  Issue : 3  |  Page : 614-618

RAD51 135G>C polymorphism and risk of sporadic colorectal cancer in Iranian population


1 Department of Genetics, Falavarjan Branch, Islamic Azad University, Isfahan, Iran
2 Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran

Date of Web Publication12-Jun-2018

Correspondence Address:
Dr. Nasrin Yazdanpanahi
Department of Genetics, Falavarjan Branch, Islamic Azad University, Isfahan
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0973-1482.183558

Rights and Permissions
 > Abstract 


Background and Aim of Study: Colorectal cancer (CRC) is among the most common cancers and accounts as the second leading cause of death from cancers in the world. RAD51 plays a crucial role in double-strand breaks repair of DNA. Single nucleotide polymorphisms within this gene could influence on the potential of DNA repair and in consequence on the susceptibility to various tumors such as CRC. This is the first report about the role of RAD51 polymorphisms in Iranian CRC susceptibility. The study was conducted to evaluate the association of 135G>C polymorphism of RAD51 gene with sporadic CRC in a subset of Iranian population.
Materials and Methods: The current case–control study was performed from 2013 to 2015. One hundred patients with sporadic CRC and one hundred controls were enrolled from two referral centers in Isfahan. All samples were genotyped for the RAD51 gene using polymerase chain reaction-restriction fragment length polymorphism assay.
Results: The results revealed no significant association between the RAD51 135G>C and sporadic CRC (odds ratio = 0.86, 95% confidence interval = 0.464–1.595). The frequency of genotypes and also alleles of the mentioned polymorphism were not significantly different between case and control groups (P = 0.2 and 0.4, respectively).
Conclusion: The results suggest that RAD51 135G>C probably has not a crucial role in Iranian CRC risk and is not an important potential risk factor in molecular diagnostics of mentioned disease among Iranian population.

Keywords: Iran, RAD51 135G>C polymorphism, sporadic colorectal cancer


How to cite this article:
Yazdanpanahi N, Salehi R, Kamali S. RAD51 135G>C polymorphism and risk of sporadic colorectal cancer in Iranian population. J Can Res Ther 2018;14:614-8

How to cite this URL:
Yazdanpanahi N, Salehi R, Kamali S. RAD51 135G>C polymorphism and risk of sporadic colorectal cancer in Iranian population. J Can Res Ther [serial online] 2018 [cited 2020 Jul 8];14:614-8. Available from: http://www.cancerjournal.net/text.asp?2018/14/3/614/183558




 > Introduction Top


Colorectal cancer (CRC) is known as the third common cancer in different countries and results in death in about 30% of patients with this disease.[1],[2] CRC is classified into three categories including 75% sporadic (the most common type), 25% familial, and hereditary. Environmental, genetic, and epigenetic agents contribute to the etiology of CRC.[3],[4],[5]

About 35% of CRC cases attribute to genetic factors.[4] The incidence of CRC has increased during the past three decades in Iran and made the disease a crucial public health problem.[6] Detection of the genetic factors involving in CRC development is beneficial for early molecular diagnostics of the disease. Screening of CRC can be useful in clinical management and reducing the burden of this disease. DNA repair is required for maintenance of genomic instability and integrity, which is a prerequisite of prevention of cancer. RAD51 plays a crucial role in double-strand breaks (DSB) repair, through homologous recombination (HR). Single nucleotide polymorphism (SNP) in RAD51 gene could impact on the potential of DNA repair and individual susceptibility to different cancers such as CRC. The polymorphism 135G>C (rs1801320) is a common SNP of RAD51. This polymorphism is located at 5′untranslated region (5′UTR) and influences on the expression of the gene.[7],[8] The present investigation was considered to evaluate the role of RAD51 135G>C polymorphism on the risk of CRC in a subgroup of Iranian population.


 > Materials and Methods Top


A total of two hundred unrelated Iranian subjects from two referral centers in Isfahan province (seyedoshohada hospital and Poursina Hakim research institution) were included in the current case–control study. The case group consisted of one hundred individuals affected to confirm sporadic CRC based on histopathological examination and with no familial history. The controls included one hundred cancer-free subjects without a history of familial CRC referred for colonoscopy.

A questionnaire (for recording of disease-related data and demographic characteristics including age, body mass index, gender, smoking, nonsteroidal anti-inflammatory drugs use rate, and activity) and also a written informed consent were received from all participating subjects. The study was approved by the Ethics Committee of Islamic Azad University of Falavarjan Branch.

DNA extraction

The genomic DNA was isolated from lymphocytes of 500 μl peripheral blood using digital negative-plus extraction Kit (Cinnagen, Iran), according to the manufacturer's instructions.

Genotyping

The genotypes of 135G>C polymorphism was determined by restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) assay. PCR was conducted in a final volume of 25 μl containing 2μl of MgCl2 (50 mM), 0.4 μl of each of the primers (10pM) (Forward: GGAACTGCAACTCATCTGGG, Reverse: TCACACACTCACCTCGGTC), 2.5 μl of Taq PCR buffer (×10), 0.5 μl of dNTP mix (10 mM), 0.1 μl of Taq DNA polymerase (5 u/μl), 2 μl of DNA (50 ng), 17.1 μl of ddH2O.

The PCR program was as follows: Initial denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s (denaturation), 58°C for 30 s (annealing), 72°C for 30 s (extension,) and final extension at 72 for 10 min.

A 178 bp length fragment containing a 135G>C polymorphic site was amplified using the mentioned PCR. Two units MvaI (BstNI) (Fermentas, Germany) restriction enzyme was applied for digesting of the entire product. The number and length of acquired fragments were analyzed using electrophoresis on 2.5% agarose gel for 1 h at 110 V and visualizing by green viewer dye under UV light.

The wild-type allele, 135G, have 1 MvaI cutting site. Therefore, digestion of this allele with the enzyme results in 69 and 109 bp fragments. A G>C substitution at position 135 abolishes the MvaI cutting site. Hence, 135C allele is not digested with the enzyme and results in a single 178 bp product. Therefore, RFLP assay revealed the following patterns: A single 178 bp fragment for C/C genotype, 69 and 109 bp fragments for G/G genotype, and 178, 69, and 109 bp fragments for G/C genotype.

Statistical analysis

Statistical Package for Social Science version 19 (SPSS Company, Chicago, IL, USA) was used for statistical analysis. The comparison of observed genotype frequencies to those expected under Hardy–Weinberg equilibrium was conducted applying the Chi-square test. The Chi-square and Fisher's exact tests were also applied to evaluate the frequency distribution of genotypes, alleles, and categorical demographic factors between study groups. In addition, a t-test was employed to compare the differences of continuous demographic characteristics between cases and controls. A logistic regression model with adjusting confounding variables was used to calculate odds ratios and 95% confidence intervals for prediction of the impact of RAD51 135G>C genotypes on sporadic CRC susceptibility. P < 0.05 was considered significant.


 > Results Top


One hundred cases of CRC and one hundred cancer-free controls were recruited to the study. Males were 52% and 53% among controls and cases, respectively. The mean age was 58.36 years (±10.363) for controls and 58.46 years (±11.576) for cases [Table 1].
Table 1: Demographic characteristics in controls and cases

Click here to view


Cases and controls had not significant variances in terms of age and sex and were sufficiently matched for these characteristics (P = 0.9 and 1, respectively) [Table 1]. In addition, no significant differences were present as regards other studied variables (except activity) between the groups [Table 1]. Physical activity was significantly lower in CRC group compared to controls (P < 0.001) [Table 1]. There was no significant association between RAD51 135G>C and CRC risk. The frequency of GG, GC, and CC genotypes was 69, 26, and 5% for controls and 72, 27, and 1% for cases, respectively. Moreover, frequencies of G and C alleles were 82 and 18% for controls and 85.5 and 14.5% for cases, respectively [Table 2].
Table 2: Genotype and allele frequencies of RAD51 135 G>C in controls and cases

Click here to view


The association between RAD51 135G>C polymorphism genotypes and CRC risk was also estimated in subgroups of participants stratified by age (under and over 55 years) and other variables [Table 3].
Table 3: Stratification analysis of RAD51 135 G>C genotype frequency in case and control groups

Click here to view


The genotypic distribution of the examined polymorphism was in Hardy–Weinberg equilibrium for the cases and controls groups (P > 0.05).


 > Discussion Top


RAD51 gene with about 30 Kb length and ten exons were mapped on 15q15.1. This gene encodes hRAD51 (37 KD) binding to single- and double-stranded DNA and involves in DSB repair of DNA trough HR.[7],[9],[10],[11] DSB is one of the major factors conferring genomic instability, which is a required step in the process of cancer development and causes activation of oncogene and silencing of tumor suppressor genes by rearrangement.[12],[13] The contribution of RAD51 in DSB process and maintenance of genomic instability, reveals the possible potential effect of its SNPs in the pathogenesis of cancers and makes them as considerable targets for studies conducting in the field of tumor risk factors.[14]

Various SNP markers spanning genomehave been described to be involved in CRC etiology.[15],[16] The role and spectrum of causative variants contributing to the occurrence of cancers such as CRC is dependent on ethnical parameters. Thus, it may need replication of studies in different populations to clarify the variants specific to any ethnicities.

G>C at nucleotide 135 (135G>C) in 5′UTR of the RAD51 is a common detected SNP in this gene and impacts on the expression level of the gene.[17],[18]

There are a few reports about the impact of RAD51 135G>C in developing of CRC in Asian populations.

RAD51 135G>C showed association with CRC in a subgroup of Kashmir population.[19] Likewise in a study recruited in Turkish, there was a correlation between CRC and the polymorphism.[20]

BRCA1 and RAD51 expression levels showed a significant positive correlation with CRC in Chinese.[21]

So far, the role of RAD51 polymorphisms in Iranian CRC has not been investigated and to the best of our knowledge, the current study is the first report about the effect of the RAD51 135G>C in the incidence of CRC in population of Iran.

Several investigations have drawn attention to the relation of RAD51 135G>C with different cancers.[22],[23] However, the association of the mentioned polymorphism with CRC is controversial. In a meta-analysis, the significant associations were observed between RAD51 135G>C and subgroups of breast, hematologic, colorectal, endometrial, and ovarian cancers. According to the analysis, RAD51 135G>C is associated with susceptibility of cancer.[24] In another meta-analysis, there was no correlation between colorectal, squamous cell, ovarian and hematologic cancers, and RAD51 135G>C.[25]

Likewise the reports about the association of RAD51 with CRC in Polish population have been in discrepancy.[8],[26],[27],[28],[29],[30]

The pooled results of a meta-analysis indicated that RAD51 135G>C correlated with risk of overall cancers, especially of breast cancer.[31] The current results do not show an association between genotype and allele frequency of RAD51 135G>C with CRC in a subgroup of Iranian population. This finding is in disagreement with the results of several studies conducted in different populations.[17],[18],[28] The frequency of C allele among controls of Turkish (Asian) and Polish (European) was 0.75 and 0.12, respectively [8],[18] but in the present study, it was calculated 0.18 among controls that probably represents the lower incidence of C allele in Iranian population compared to that in Turkish population. The discrepancy in the reported investigations including our study about the association between RAD51 135G>C polymorphism and CRC maybe suggests that the effect of mentioned polymorphism exerts in relation with other genetic factors or environmental agents. However, the difference between the size, ethnicity of the samples, and also statistical methods might be alternative causes.





With regard to the worldwide, increasing incidence of life-threatening disease, CRC, investigation of different CRC responsible factors such as SNPs amenable to early screening and management of this disorder is very helpful. As a result of our study, RAD51 135G>C probably does not impact on CRC susceptibility in Iranian population and other risk factors should be considered for improvement of management facilities of the disease in Iran. However, further studies investigating the impression of gene-gene and gene-environment interactions are warranted to access a comprehensive and exact conclusion about the effect of RAD51 135G>C on the occurrence of cancers such as CRC.

Acknowledgments

The authors would like to gratefully acknowledge to Department of Biology and Genetics, Islamic Azad University of Falavarjan Branch, Department of Genetics, Isfahan University of Medical Sciences and all studied families for their sincere cooperation. This study is a part of the research proposal (number: 28238) conducted by Nasrin Yazdanpanahi and was supported by Falavarjan Branch, Islamic Azad University.

Financial support and sponsorship

Falavarjan Branch, Islamic Azad University, Isfahan, Iran.

Conflicts of interest

There are no conflicts of interest.



 
 > References Top

1.
Haggar FA, Boushey RP. Colorectal cancer epidemiology: Incidence, mortality, survival, and risk factors. Clin Colon Rectal Surg 2009;22:191-7.  Back to cited text no. 1
[PUBMED]    
2.
Sargent DJ, Goldberg RM, Jacobson SD, Macdonald JS, Labianca R, Haller DG, et al. A pooled analysis of adjuvant chemotherapy for resected colon cancer in elderly patients. N Engl J Med 2001;345:1091-7.  Back to cited text no. 2
[PUBMED]    
3.
Fahy B, Bold RJ. Epidemiology and molecular genetics of colorectal cancer. Surg Oncol 1998;7:115-23.  Back to cited text no. 3
[PUBMED]    
4.
Lichtenstein P, Holm NV, Verkasalo PK, Iliadou A, Kaprio J, Koskenvuo M, et al. Environmental and heritable factors in the causation of cancer – Analyses of cohorts of twins from Sweden, Denmark, and Finland. N Engl J Med 2000;343:78-85.  Back to cited text no. 4
[PUBMED]    
5.
Chan AT, Giovannucci EL. Primary prevention of colorectal cancer. Gastroenterology 2010;138:2029-43.e10.  Back to cited text no. 5
    
6.
Dolatkhah R, Somi MH, Bonyadi MJ, Asvadi Kermani I, Farassati F, Dastgiri S. Colorectal cancer in Iran: Molecular epidemiology and screening strategies. J Cancer Epidemiol 2015;2015:643020.  Back to cited text no. 6
[PUBMED]    
7.
Gupta RC, Bazemore LR, Golub EI, Radding CM. Activities of human recombination protein Rad51. Proc Natl Acad Sci U S A 1997;94:463-8.  Back to cited text no. 7
[PUBMED]    
8.
Mucha B, Przybylowska-Sygut K, Dziki L, Dziki A, Sygut A, Majsterek I. Lack of association between the 135G/C RAD51 gene polymorphism and the risk of colorectal cancer among Polish population. Pol Przegl Chir 2012;84:358-62.  Back to cited text no. 8
    
9.
Schmutte C, Tombline G, Rhiem K, Sadoff MM, Schmutzler R, von Deimling A, et al. Characterization of the human Rad51 genomic locus and examination of tumors with 15q14-15 loss of heterozygosity (LOH). Cancer Res 1999;59:4564-9.  Back to cited text no. 9
[PUBMED]    
10.
Benson FE, Stasiak A, West SC. Purification and characterization of the human Rad51 protein, an analogue of E. coli RecA. EMBO J 1994;13:5764-71.  Back to cited text no. 10
[PUBMED]    
11.
Sung P. Catalysis of ATP-dependent homologous DNA pairing and strand exchange by yeast RAD51 protein. Science 1994;265:1241-3.  Back to cited text no. 11
[PUBMED]    
12.
Elliott B, Jasin M. Double-strand breaks and translocations in cancer. Cell Mol Life Sci 2002;59:373-85.  Back to cited text no. 12
[PUBMED]    
13.
Khanna KK, Jackson SP. DNA double-strand breaks: Signaling, repair and the cancer connection. Nat Genet 2001;27:247-54.  Back to cited text no. 13
[PUBMED]    
14.
Thacker J. The RAD51 gene family, genetic instability and cancer. Cancer Lett 2005;219:125-35.  Back to cited text no. 14
[PUBMED]    
15.
Osian G, Procopciuc L, Vlad L. MTHFR polymorphisms as prognostic factors in sporadic colorectal cancer. J Gastrointestin Liver Dis 2007;16:251-6.  Back to cited text no. 15
[PUBMED]    
16.
Daraei A, Salehi R, Salehi M, Emami MH, Janghorbani M, Mohamadhashem F, et al. Effect of rs6983267 polymorphism in the 8q24 region and rs4444903 polymorphism in EGF gene on the risk of sporadic colorectal cancer in Iranian population. Med Oncol 2012;29:1044-9.  Back to cited text no. 16
[PUBMED]    
17.
Richardson C, Stark JM, Ommundsen M, Jasin M. Rad51 overexpression promotes alternative double-strand break repair pathways and genome instability. Oncogene 2004;23:546-53.  Back to cited text no. 17
[PUBMED]    
18.
Levy-Lahad E, Lahad A, Eisenberg S, Dagan E, Paperna T, Kasinetz L, et al. A single nucleotide polymorphism in the RAD51 gene modifies cancer risk in BRCA2 but not BRCA1 carriers. Proc Natl Acad Sci U S A 2001;98:3232-6.  Back to cited text no. 18
[PUBMED]    
19.
Nissar S, Baba SM, Akhtar T, Rasool R, Shah ZA, Sameer AS. RAD51 G135C gene polymorphism and risk of colorectal cancer in Kashmir. Eur J Cancer Prev 2014;23:264-8.  Back to cited text no. 19
[PUBMED]    
20.
Cetinkunar S, Gok I, Celep RB, Ilhan D, Erdem H, Bilgin BC, et al. The effect of polymorphism in DNA repair genes RAD51 and XRCC2 in colorectal cancer in Turkish population. Int J Clin Exp Med 2015;8:2649-55.  Back to cited text no. 20
[PUBMED]    
21.
Xiaoding Y, Yong CH, Weixue T, Jianfeng J, Chuanxu L. Expression and clinical significance of RAD51 and BRCA1 in colorectal. Chin J Histochem Cytochem 2013;1:54-8.  Back to cited text no. 21
    
22.
Zhou GW, Hu J, Peng XD, Li Q. RAD51 135G>C polymorphism and breast cancer risk: A meta-analysis. Breast Cancer Res Treat 2011;125:529-35.  Back to cited text no. 22
[PUBMED]    
23.
Jakubowska A, Gronwald J, Menkiszak J, Górski B, Huzarski T, Byrski T, et al. The RAD51 135 G>C polymorphism modifies breast cancer and ovarian cancer risk in Polish BRCA1 mutation carriers. Cancer Epidemiol Biomarkers Prev 2007;16:270-5.  Back to cited text no. 23
    
24.
Sun GL, Zhang BB, Xuan C, Deng KF, Gao G, Lun LM. RAD51 135G>C polymorphism and cancer risk: An updated meta-analysis involving 54,239 subjects. Austin J Pharmacol Ther 2014;2:9.  Back to cited text no. 24
    
25.
Cheng D, Shi H, Zhang K, Yi L, Zhen G. RAD51 Gene 135G/C polymorphism and the risk of four types of common cancers: A meta-analysis. Diagn Pathol 2014;9:18.  Back to cited text no. 25
[PUBMED]    
26.
Krupa R, Sliwinski T, Wisniewska-Jarosinska M, Chojnacki J, Wasylecka M, Dziki L, et al. Polymorphisms in RAD51, XRCC2 and XRCC3 genes of the homologous recombination repair in colorectal cancer – A case control study. Mol Biol Rep 2011;38:2849-54.  Back to cited text no. 26
[PUBMED]    
27.
Wisniewska-Jarosinska M, Sliwinfski T, Krupa R, Stec-Michalska K, Chojnacki J, Blasiak J. The role of RAD 51 gene polymorphism in patients with colorectal cancer in the Polish subpopulation. Pol Merkur Lekarski 2009;26:455-7.  Back to cited text no. 27
    
28.
Romanowicz-Makowska H, Samulak D, Michalska M, Sporny S, Langner E, Dziki A, et al. RAD51 gene polymorphisms and sporadic colorectal cancer risk in Poland. Pol J Pathol 2012;63:193-8.  Back to cited text no. 28
[PUBMED]    
29.
Garstka M, Przybylowska K, Kulig A, Zadrozny M, Pertynski T, Dziki A. et al. A single nucleotide polymorphism in the RAD51 gene in colorectal cancer. Exp Oncol 2003;25:40-2.  Back to cited text no. 29
    
30.
Mucha B, Kabzinski J, Dziki A, Przybylowska-Sygut K, Sygut A, Majsterek I, et al. Polymorphism within the distal RAD51 gene promoter is associated with colorectal cancer in a Polish population. Int J Clin Exp Pathol 2015;8:11601-7.  Back to cited text no. 30
[PUBMED]    
31.
Zhao M, Chen P, Dong Y, Zhu X, Zhang X. Relationship between Rad51 G135C and G172T variants and the susceptibility to cancer: A meta-analysis involving 54 case-control studies. PLoS One 2014;9:e87259.  Back to cited text no. 31
[PUBMED]    



 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Conclusion>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed1792    
    Printed70    
    Emailed0    
    PDF Downloaded126    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]