Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2018  |  Volume : 14  |  Issue : 1  |  Page : 24-29

Heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 is a novel regulator of transforming growth factor-beta-mediated epithelial-to-mesenchymal transition and regulated by miR-218 in nonsmall cell lung cancer


1 Department of Respiratory Diseases, The Second Affiliated Hospital of Soochow University, Suzhou, PR China
2 Department of Respiratory Medicine, Nanjing Drum Tower Hospital Affiliated to Medical School of Nanjing University, Nanjing, PR China

Date of Web Publication8-Mar-2018

Correspondence Address:
Prof. Minhua Shi
Department of Respiratory Diseases, The Second Affiliated Hospital of Soochow University, Suzhou
PR China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jcrt.JCRT_659_17

Rights and Permissions
 > Abstract 

Background: Due to high metastasis and recurrence rate. Recent studies indicated that epithelial-to-mesenchymal transition (EMT) was involved in the progression and metastasis in cancer. Some reports also indicate that HS3ST3B1 played a role in angiogenesis and the proliferation of cancer cells. In this study, we aim to investigate its role in non-small cell lung cancer (NSCLC) .
Materials and Methods: All cell lines were purchased from ATCC and cultured in our central lab. RT-PCR was performed to study the expession of HS3ST3B1 in tumors and matched normal tissues. Western-blot was used to investigate the expession of HS3ST3B1 in cell lines. We also used luciferase report system to confirm the regulation of HS3ST3B1 by miR-218 in cells.
Results: In this study, we found that HS3ST3B1 was significantly upregulated in NSCLC tissues compared with matched normal tissues (P = 0.02). Its expression was also up-regulated in mesenchymal phenotype of NSCLC cell lines compared with epithelial phenotype (P < 0.05). When TGF-β was applied to induce the epithelial phenotype to mesenchymal phenotype, it was upregulated compared with previous epithelial cell lines. When HS3ST3B1 was knocked down by specific small interfering RNA in the mesenchymal phenotype, mesenchymal phenotype was transformed to epithelial phenotype. Moreover, we also found that it could be targeted by miR-218 in NSCLC.
Conclusion: These findings indicate that HS3ST3B1 is a novel regulator of TGF-beta-mediated EMT and is regulated by miR-218 in NSCLC.

Keywords: Epithelial-to-mesenchymal transition, heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1, miR-218, nonsmall cell lung cancer, transforming growth factor-beta


How to cite this article:
Zhang Z, Jiang H, Wang Y, Shi M. Heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 is a novel regulator of transforming growth factor-beta-mediated epithelial-to-mesenchymal transition and regulated by miR-218 in nonsmall cell lung cancer. J Can Res Ther 2018;14:24-9

How to cite this URL:
Zhang Z, Jiang H, Wang Y, Shi M. Heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 is a novel regulator of transforming growth factor-beta-mediated epithelial-to-mesenchymal transition and regulated by miR-218 in nonsmall cell lung cancer. J Can Res Ther [serial online] 2018 [cited 2019 Nov 14];14:24-9. Available from: http://www.cancerjournal.net/text.asp?2018/14/1/24/226747


 > Introduction Top


Lung cancer remained the top cause of cancer-related death worldwide.[1] Patients with nonsmall cell lung cancer (NSCLC), representing approximately 80%–85% of lung cancer, still have a dismay 5-year survival rate of 10%–15% for all stages.[2] Most patients were inoperable, with metastasis either in nearby regional lymph nodes or distant sites at the time of diagnosis. When there was metastasis, survival time of patients became even shorter compared with patients without any metastasis, ranging from 8 to 10 months.[3] Therefore, there was an urgent need to unravel the molecular mechanism leading to invasion and metastasis in NSCLC. Such endeavor will facilitate the development of advanced therapeutic treatments and improve the clinical outcome of NSCLC.

Activation of migration, invasion, and metastasis was a crucial characteristic of cancer, and one of the hallmark capabilities was its malignancy.[4] Metastasis was one of the major causes of cancer recurrence and tumor-related death.[5],[6] Recent studies investigating metastasis mechanisms indicated that epithelial-to-mesenchymal transition (EMT) was an important step during tumor progression.[7] It showed that transforming growth factor-beta (TGF-β) signaling played a critical role in EMT. In fact, adding TGF-β to epithelial cells in culture was a convenient way to induce EMT in various epithelial cells, including NSCLC cell lines.[8] Thus, to understand the involvement of EMT in NSCLC was crucial to unpack the myth of metastasis in NSCLC.

Heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 (HS3ST3B1) participated in the biosynthetic steps of heparan sulfate (HS) and targeted vascular endothelial growth factor (VEGF) in acute myeloid leukemia (AML) cells, thus contributing to angiogenesis and proliferation of AML cells.[9],[10] However, the role of HS3ST3B1 in NSCLC has never been reported. In this study, we found that HS3ST3B1 was significantly upregulated in tumors compared to that of in matched normal tissues. Its expression was also upregulated in mesenchymal phenotype NSCLC cells lines. When it was knocked down by small interfering RNA (siRNA), mesenchymal phenotype was transformed to epithelial phenotype. MicroRNAs (miRNAs) have been demonstrated to regulate approximately one-third genes in human. MiR-218 was found to be deleted or downregulated in squamous lung cancer and hepatocellular carcinoma.[11],[12] Furthermore, it has also been demonstrated to target Rictor in cervical and oral cancer cells to modulate tumor growth and chemosensitivity.[13],[14] In this study, we observed that it could be regulated by miR-218 in NSCLC. Thus, HS3ST3B1 may be a novel regulator of TGF-β-mediated EMT and regulated by miR-218 in NSCLC.


 > Materials and Methods Top


Antibodies and reagents

All antibodies were bought from Cell Signaling Technology (CST, USA). Recombinant human TGF-β was purchased from Peprotech (Rocky Hill, NJ, USA). Other reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless specifically indicated.

Cell lines, cell culture, and tumors

The human NSCLC cell lines CALU6 (#HTB-56), H460 (#HTB-177), H1975 (#CRL-5908), A549 (#CCL-185), HCC827 (#CRL-2868), and H358 (#CRL-5807) were purchased from the American Type Culture Collection (Manassas, VA, USA). All the cell lines were cultured in RPMI-1640 medium (Invitrogen, CA, USA) with 10% fetal bovine serum and 100 U/mL penicillin/streptomycin (Sigma, St. Louis, MO, USA). The NSCLC tumors and matched normal tissues were obtained from and preserved in the Department of General Surgery, Drum Tower Hospital, Affiliated to the Medical School of Nanjing University. Informed consent was obtained from patients and this study was approved by the Ethics Committee of the Medical School of Nanjing University.

Real-time quantitative reverse transcription polymerase chain reaction

Total RNA of NSCLC tissue samples or matched normal tissues were extracted with TRIzol reagent (Invitrogen, CA, USA). The concentration of isolated total RNA was measured on a NanoDrop ND-1000 Spectrophotometer (Agilent, CA, USA). For mRNA detection, the reverse transcription of total RNA was performed with the SuperScript III First-Strand Synthesis System kit, and then, the product was amplified with the SsoFast™ EvaGreen ® Supermix. The primers for HS3ST3B1 were 5'-TAGCGTGGTTCTGCCTTCTT-3' (F) and 5'-GACCAGGTGAAGGACTTGGA-3' (R). The primers for HPRT1 were TGACACTGGCAAAACAATGCA (F) and GGTCCTTTTCACCAGCAAGCT (R). Primers for CDH1 and VIM were 5'-AGTGGGCACAGATGGTGTGA-3' (F), 5'-TAGGTGGAGTCCCAGGCGTA-3' (R) and 5'-CCTCACCTGTGAAGTGGATGC-3' (F) 5'-CAAC GGCAAAGTTCTCTTCCA-3' (R), respectively. The sequence-specific forward primers for mature miR-218 and U6 internal control were CGTTGTGCTTGATCTAACCATGT (23 bps, GC = 43.49%, Tm = 60.4) and 5'-CTCGCTTCGGCAGCACA-3', respectively. HPRT1 and U6 internal control were applied as endogenous controls, and fold changes were calculated through relative quantification (2−ΔCt).

Western blotting

The H1975 cells were transfected with P-miR-218 for 72 h and then washed twice with phosphate-buffered saline (PBS). Then, the transfected cells were solubilized in radioimmunoprecipitation assay lysis buffer. The supernatants, which contained whole cell protein extracts, were obtained after centrifugation of the cell lysates at 12,000 g for 10 min at 4°C. The protein concentration was determined with the DC protein assay (Bio-RAD, USA). Heat-denatured protein samples (20 μg per lane) were resolved with sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to an immobilon-P membrane (Millipore, Bedford, MA, USA). The membrane was incubated for 60 min in PBS containing 0.1% Tween 20 and 5% skim milk to block nonspecific binding. Then, the blocked membrane was incubated for 1 h at room temperature with a primary antibody and washed three times for 10 min in PBS with 0.1% Tween 20. Finally, the membrane was incubated for 1 h with a secondary antibody and washed thoroughly in PBS containing 0.1% Tween 20. The bound antibody was detected with enhanced chemiluminescence detection reagents (Amersham Biosciences) according to the manufacturer's instructions.

Luciferase reporter assay

The potential miRNAs targeting HS3ST3B1 were selected by bioinformatic analysis. The 3'-UTR sequence of HS3ST3B1, which was predicted to interact with the miRNAs, was synthesized and inserted into the XbaI and FseI sites of the pGL3 control vector (Promega, Madison, WI, USA). For the reporter assay, HEK293 cells were plated onto 24-well plates and transfected with the above constructs and miR-218 mimics or mimic-controls with the lipofectamine 3000 transfection reagent (Life Technologies, USA). A renilla luciferase vector pRL-SV50 (Promega, Madison, WI, USA) was also cotransfected to normalize the differences in transfection efficiency. After transfection for 48 h, cells were harvested and detected with the Dual-Luciferase Reporter Assay System (Promega, Madison, WI) according to the manufacturer's instructions. This experiment was performed in duplicate for three independent experiments.

Statistical analysis

Data were presented as mean ± standard deviation (SD). The data were analyzed with SPSS 12.0 Windows version software (SPSS Inc, Chicago, IL, USA). Statistical analyses were performed by analysis of variance or Student's t-test. P < 0.05 was considered statistically significant.


 > Results Top


Heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 was upregulated in lung cancer tissues and cell lines and associated with epithelial-to-mesenchymal transition

Since HS3ST3B1 played an important role in AML cell angiogenesis and proliferation, it was interesting to investigate the role of HS3ST3B1 in NSCLC. The expression levels of HS3ST3B1 in tumors (n = 20) and matched normal tissues (n = 20) were compared by quantitative reverse transcription polymerase chain reaction (qRT-PCR), both for mesenchymal and epithelial NSCLC cell lines. Interestingly, HS3ST3B1 was upregulated in NSCLC tumors, while it was downregulated in matched normal tissues [Figure 1]a. Moreover, we analyzed the expression of HS3ST3B1 in representative NSCLC cell lines. To our surprise, the expression of HS3ST3B1 was higher in the mesenchymal phenotype of NSCLC compared with that of epithelial phenotype NSCLC cell lines [Figure 1]b; the expression in both NSCLC cell lines was higher than that of in normal lung tissue [Figure 1]b. Thus, HS3ST3B1 may not only be involved in the progression or development of NSCLC but also could play an important role in the EMT process in NSCLC.
Figure 1: The expression of heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 was increased in lung cancer and mesenchymal phenotype nonsmall cell lung cancer cell lines. (a) The gene expression of heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 was significantly increased in 20 cases of nonsmall cell lung cancers compared with that of matched normal tissues tested by quantitative reverse transcription polymerase chain reaction (P = 0.002). (b) The expression of heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 was upregulated in mesenchymal phenotype of nonsmall cell lung cancer cell lines compared with that of epithelial phenotype (P < 0.05)

Click here to view


The expression of heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 was significantly increased in epithelial lung cancer cells with transforming growth factor-beta-mediated epithelial-to-mesenchymal transition

TGF-β was a convenient way to induce the EMT process in tumors; thus, to investigate the significance of HS3ST3B1 in the EMT process of NSCLC, epithelial NSCLC cell lines (A549 and HCC827) were first induced to mesenchymal phenotype with TGF-β. After 96 h of culturing with TGF-β, we observed the morphologic change of appearance of A549 and HCC827. Apparently, the A549 and HCC827 cells lost the close connection with each other and developed spindle-shaped morphology under microscope [Figure 2]a. The loss of E-cadherin was considered to be a fundamental event in EMT; thus, we next analyzed the EMT-related genes, CDH1 and VIM in TGF-β cultured A549 and HCC827 cells. Not surprisingly, the gene coding E-cadherin, CDH1, was downregulated while the gene coding vimentin, VIM, was upregulated [Figure 2]b, indicating that A549 and HCC827 were successfully transformed from epithelial phenotype to mesenchymal phenotype with TGF-β. More interestingly, when the expression of HS3ST3B1 was analyzed again in the mesenchymal phenotype induced by TGF-β, we observed that it was significantly upregulated. These results suggested that HS3ST3B1 may be involved in the process of EMT in NSCLC.
Figure 2: Heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 was increased in transforming growth factor-beta-induced epithelial-to-mesenchymal transition process. (a) Both A549 and HCC827 were epithelial phenotype of nonsmall cell lung cancer. After inducing by transforming growth factor-beta, both cell lines were transformed to mesenchymal phenotype morphologically. (b) CDH1 was the gene of E-cadherin and VIM was the gene of vimentin, they were both epithelial-to-mesenchymal transition biomarkers. CDH1, the epithelial biomarker, was increased in A549 and HCC827. And VIM, the mesenchymal biomarker, was upregulated in transforming growth factor-beta-induced A549 and HCC827. When epithelial phenotype of A549 and HCC827 were transformed to mesenchymal phenotypes induced by transforming growth factor-beta, the expression of heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 was significantly increased (×100)

Click here to view


Knockdown of heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 reversed the mesenchymal phenotype of lung cancer cells

We have demonstrated that HS3ST3B1 was upregulated when NSCLC transformed from the epithelial phenotype to the mesenchymal phenotype; therefore, it was interesting to investigate whether the knockdown of HS3ST3B1 could reverse the EMT process. First, we selected two mesenchymal phenotypes: NSCLC-H460 and H1975. Both of them appeared mesenchymal morphology. Then, siRNA was applied to knockdown the expression of HS3ST3B1; to our surprise, the cells lost their spindle-shaped appearance compared to that of siRNA control transfection [Figure 3]a. More importantly, we analyzed the epithelial and mesenchymal marker-related genes and found that when HS3ST3B1 was knocked down, CDH1 was upregulated and VIM was downregulated [Figure 3]b. These results indicated that the expression of HS3ST3B1 was essential to maintain the mesenchymal phenotype in NSCLC cells. After the knockdown of HS3ST3B1, the mesenchymal phenotype could be induced to transform to epithelial phenotype in NSCLC. Together with previous results, we confirmed that HS3ST3B1 may be a novel regulator of EMT in NSCLC.
Figure 3: Silence of heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 induced mesenchymal-epithelial transition in the mesenchymal phenotype of nonsmall cell lung cancer cell lines. (a) Morphological change from an elongated fibroblastic phenotype of H460 and H1975 to an epithelial cobblestone phenotype when heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 was suppressed by small interfering RNA. (b) Expression of epithelial-to-mesenchymal transition-related genes, CDH1 and VIM in H460 and H1975 cells were stably transfected with sh-Control or sh-heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 (×100)

Click here to view


The expression of heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 was regulated by miR-218 in lung cancer cells

Since HS3ST3B1 played an important role in NSCLC EMT process, it was interesting to investigate the regulation of HS3ST3B1 expression. Previous studies have suggested that at least one-third of human genes were estimated to be the targets of miRNA, so the regulation mediated by miRNA at the posttranscriptional level was pervasive in animals.[15] To identify the potential posttranscriptional regulation of HS3ST3B1 by miRNAs, miRNA target prediction tools such asTargetScan/TargertScanS were applied. A significant expression correlation was observed between HS3ST3B1 and miR-218 [Figure 4]a, suggesting that HS3ST3B1 may be regulated by miR-218. To validate whether miR-218 directly recognized the 3'-UTRs of HS3ST3B1 mRNA, the 3'UTR of HS3ST3B1 was cloned to the pGL3 luciferase reporter gene to generate pGL3-HS3ST3B1-3'UTR or pGL3-control vectors. The vectors were then cotransfected with miR-218 mimics or mimic controls into HEK293 cells. A renilla luciferase vector (pRL-TK) was applied to normalize differences in transfection efficiency. Luciferase activity in cells cotransfected with miR-218 mimics and pGL3-HS3ST3B1-3'UTR vectors was decreased when compared with the control [Figure 4]d. Next, we further detected the protein expression of HS3ST3B1 in cells after transfection with miR-218 mimics or mimic controls. The results showed that the expression of HS3ST3B1 was decreased by the overexpression of miR-218 [Figure 4]b and [Figure 4]c. These data suggested that the expression of HS3ST3B1 could be regulated by miR-218 in NSCLC.
Figure 4: Heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 was identified as a functional downstream target of miR-218. (a) Bioinformatics was applied to predict the binding sites between miR-218 and heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1-3'UTR-wt and mutation. (b) Quantitative reverse transcription polymerase chain reaction was applied to test the expression of miR-218 relative to U6 after the transfection of miR-218 mimics and mimic control. (c) Total cell lysates were extracted from p-miR-218 or p-miR-control vector-transfected cells then analyzed by Western blot. (d) The relative luciferase activity of cells cotransfection with p-miR-218 or p-miR-control vector and pGL3-heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1-3'UTR-wt or mutation vector

Click here to view



 > Discussion Top


EMT in cancer was a highly coordinated process, by which tumor cells acquired new characters (such as the expression of mesenchymal markers and loss of epithelial markers) and underwent profound morphogenetic changes.[16] It has been extensively studied and demonstrated to play an important role in cancer progression, maintenance of stemness, and chemotherapeutic drug resistance.[17] The EMT process could be controlled by intrinsic oncogenic activation such as K-ras mutation or HER2 overexpression.[18],[19] Furthermore, this process can be triggered by external stimuli such as Wnt, TGF-β, Hedgehog, epidermal growth factor, hepatocyte growth factor, and cytokines such as IL-6.[20] In this study, we first found that HS3ST3B1 was upregulated in NSCLC, indicating that it might be involved in the development or progression of NSCLC. Next, we found that it was also upregulated in mesenchymal phenotype cell lines, suggesting that it might promote the EMT process.

Next, we applied TGF-β to induce epithelial phenotype NSCLC cell lines into the mesenchymal phenotype. The change of morphology to spindle-shaped indicated that the cells had undergone the EMT process, and the CDH1 downregulation and VIM upregulation suggested that they were successfully transformed to the mesenchymal phenotype molecularly. When they became mesenchymal tumor cells, and consistently with the previous results, we found that even in epithelial phenotype induced by TGF-β into mesenchymal phenotype cells, HS3ST3B1 was also upregulated, confirming that it might be a novel regulator of EMT process in NSCLC.

HS3ST3B1 participated in the biosynthetic steps of HS and has been found to target VEGF in AML cells, thus contributing to the angiogenesis and proliferation of AML cells.[10] It also reported that HBV replication and viral protein expression could be effectively inhibited in vitro.[20] However, it has never been reported in NSCLC. In our study, we first explored that HS3ST3B1 was upregulated in NSCLC, and it was also able to regulate the EMT process of NSCLC, confirming that it might be associated with the progression and metastasis of NSCLC. These observations need to be warranted in more research. The shortcoming was the absence of a mechanism by which the EMT process was regulated with HS3ST3B1.

Moreover, about one-third genes have been demonstrated to be regulated by miRNAs in mammals.[21],[22] Whether HS3ST3B can be regulated by miRNA in NSCLC has been an interesting question. To answer this question, we first applied computational software to predict which miRNA targeted HS3ST3B based on the partial or complete complementarity between miRNAs and mRNA transcripts. Then, we found that miR-218 may target HS3ST3B in cells. Further, the luciferase report system was established and the results demonstrated that miR-218 did regulate HS3ST3B in cells. The forced expression of miR-218 can downregulate the expression of HS3ST3B, confirming its transcriptional regulation of HS3ST3B in cancer cells. In our study, it may target HS3ST3 and be involved in the EMT process of NSCLC.


 > Conclusion Top


We found that HS3ST3B can regulate the TGF-β-induced EMT process, and it can also be regulated by miR-218 in NSCLC. However, the mechanism on its regulation of the EMT process would warrant future research.

Financial support and sponsorship

This project is subject to the second Affiliated hospital of Soochow University preponderant clinic discipline group project funding (XKQ2015005).

Conflicts of interest

There are no conflicts of interest.

 
 > References Top

1.
Jemal A. Global burden of cancer: Opportunities for prevention. Lancet 2012;380:1797-9.  Back to cited text no. 1
    
2.
Verdecchia A, Francisci S, Brenner H, Gatta G, Micheli A, Mangone L, et al. Recent cancer survival in Europe: A 2000-02 period analysis of EUROCARE-4 data. Lancet Oncol 2007;8:784-96.  Back to cited text no. 2
    
3.
Turk F, Gursoy S, Yaldiz S, Yuncu G, Yazgan S, Basok O, et al. Comparison of clinical and pathological tumor, node and metastasis staging of lung cancer: 15-year experience with 530 patients. Minerva Chir 2011;66:509-16.  Back to cited text no. 3
    
4.
Hanahan D, Weinberg RA. The hallmarks of cancer. Cell 2000;100:57-70.  Back to cited text no. 4
    
5.
Mehlen P, Puisieux A. Metastasis: A question of life or death. Nat Rev Cancer 2006;6:449-58.  Back to cited text no. 5
    
6.
Weigelt B, Peterse JL, van 't Veer LJ. Breast cancer metastasis: Markers and models. Nat Rev Cancer 2005;5:591-602.  Back to cited text no. 6
    
7.
Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer 2002;2:442-54.  Back to cited text no. 7
    
8.
Xu J, Lamouille S, Derynck R. TGF-beta-induced epithelial to mesenchymal transition. Cell Res 2009;19:156-72.  Back to cited text no. 8
    
9.
Zhang Z, Liu X, Chen J, Su H, Luo Q, Ye J, et al. Heparin sulphate D-glucosaminyl 3-O-sulfotransferase 3B1 plays a role in HBV replication. Virology 2010;406:280-5.  Back to cited text no. 9
    
10.
Zhang L, Song K, Zhou L, Xie Z, Zhou P, Zhao Y, et al. Heparan sulfate D-glucosaminyl 3-O-sulfotransferase-3B1 (HS3ST3B1) promotes angiogenesis and proliferation by induction of VEGF in acute myeloid leukemia cells. J Cell Biochem 2015;116:1101-12.  Back to cited text no. 10
    
11.
Davidson MR, Larsen JE, Yang IA, Hayward NK, Clarke BE, Duhig EE, et al. MicroRNA-218 is deleted and downregulated in lung squamous cell carcinoma. PLoS One 2010;5:e12560.  Back to cited text no. 11
    
12.
Xiao ZD, Jiao CY, Huang HT, He LJ, Zhao JJ, Lu ZY, et al. MiR-218 modulate hepatocellular carcinoma cell proliferation through PTEN/AKT/PI3K pathway and hoxA10. Int J Clin Exp Pathol 2014;7:4039-44.  Back to cited text no. 12
    
13.
Li J, Ping Z, Ning H. MiR-218 impairs tumor growth and increases chemo-sensitivity to cisplatin in cervical cancer. Int J Mol Sci 2012;13:16053-64.  Back to cited text no. 13
    
14.
Uesugi A, Kozaki K, Tsuruta T, Furuta M, Morita K, Imoto I, et al. The tumor suppressive microRNA miR-218 targets the mTOR component rictor and inhibits AKT phosphorylation in oral cancer. Cancer Res 2011;71:5765-78.  Back to cited text no. 14
    
15.
He L, Hannon GJ. MicroRNAs: Small RNAs with a big role in gene regulation. Nat Rev Genet 2004;5:522-31.  Back to cited text no. 15
    
16.
Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest 2009;119:1420-8.  Back to cited text no. 16
    
17.
Singh A, Settleman J. EMT, cancer stem cells and drug resistance: An emerging axis of evil in the war on cancer. Oncogene 2010;29:4741-51.  Back to cited text no. 17
    
18.
Edme N, Downward J, Thiery JP, Boyer B. Ras induces NBT-II epithelial cell scattering through the coordinate activities of rac and MAPK pathways. J Cell Sci 2002;115:2591-601.  Back to cited text no. 18
    
19.
Jenndahl LE, Isakson P, Baeckström D. C-erbB2-induced epithelial-mesenchymal transition in mammary epithelial cells is suppressed by cell-cell contact and initiated prior to E-cadherin downregulation. Int J Oncol 2005;27:439-48.  Back to cited text no. 19
    
20.
Thiery JP, Acloque H, Huang RY, Nieto MA. Epithelial-mesenchymal transitions in development and disease. Cell 2009;139:871-90.  Back to cited text no. 20
    
21.
Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res 2009;19:92-105.  Back to cited text no. 21
    
22.
Bartel DP. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004;116:281-97.  Back to cited text no. 22
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Conclusion>Article Figures
  In this article
>References

 Article Access Statistics
    Viewed1130    
    Printed17    
    Emailed0    
    PDF Downloaded34    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]