Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2018  |  Volume : 14  |  Issue : 12  |  Page : 1004-1011

miR-27a is highly expressed in H1650 cancer stem cells and regulates proliferation, migration, and invasion


1 Key Laboratory of Nutrition and Metabolism, Institute for Nutritional Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, University of Chinese Academy of Sciences, Shanghai, China
2 Key Laboratory of Systems Biomedicine Ministry of Education, Shanghai Center for Systems Biomedicine, Shanghai Jiao Tong University, Shanghai, China

Date of Web Publication11-Dec-2018

Correspondence Address:
Zhixue Liu
Room 2010, New Life Building, 320 Yueyang Road, Shanghai
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0973-1482.199450

Rights and Permissions
 > Abstract 


Background: Cancer stem cells (CSCs) are responsible for tumor relapse after chemotherapy and radiotherapy in non-small cell lung cancer (NSCLC). The aim of this study is to explore the profile and role of microRNA (miRNA) in CSC of NSCLC.
Materials and Methods: We studied the expression of stem cell marker in side population cells and serum-free cultured spheres of NSCLC. We identified that CD133+ CD34 cells are NSCLC stem cell. We isolated CD133+ CD34 cells and CD133 CD34+ cells with MicroBead Kit. We verified that H1650 CD133+ CD34 cells have CSC characteristics with doxorubicin, radiation, and xenograft. We studied miRNA expression profile in H1650 and HCC827 CD133+ CD34 cells with microarray analysis. We detected proliferation, migration, and invasion with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, scratch test, and Transwell chamber invasion assay, respectively.
Results: CD133 and CD34 are CSC markers in H1650. We demonstrated that H1650 CD133+ CD34 cells have CSC characteristics and found that miR-27a was highly expressed in H1650 CD133+ CD34 cells. In addition, we showed that miR-27a regulates proliferation, migration, and invasion in H1650 cell line and demonstrated that miR-27a expression was positively related to epidermal growth factor receptor in NSCLC cell lines.
Conclusions: CD133+ CD34 is a CSC marker in H1650. miR-27a is highly expressed in H1650 CSCs and regulates cancer development in H1650. miR-27a may be a potential target for NSCLC therapy.

Keywords: Cancer stem cells, epidermal growth factor receptor, lung cancer, microRNA


How to cite this article:
Luo W, Zhang D, Ma S, Wang C, Zhang Q, Wang H, He K, Liu Z. miR-27a is highly expressed in H1650 cancer stem cells and regulates proliferation, migration, and invasion. J Can Res Ther 2018;14, Suppl S5:1004-11

How to cite this URL:
Luo W, Zhang D, Ma S, Wang C, Zhang Q, Wang H, He K, Liu Z. miR-27a is highly expressed in H1650 cancer stem cells and regulates proliferation, migration, and invasion. J Can Res Ther [serial online] 2018 [cited 2019 Sep 19];14:1004-11. Available from: http://www.cancerjournal.net/text.asp?2018/14/12/1004/199450




 > Introduction Top


Lung cancer is the most common cause of cancer-related death worldwide. According to disease patterns and treatment strategies, lung cancer is classified into two main types: Small cell lung cancer (SCLC) and non-SCLC (NSCLC). The majority of cases are NSCLC (85%), which has been divided into three types: adenocarcinoma (AC), squamous cell carcinoma, and large cell carcinoma.[1],[2]

Epidermal growth factor receptor (EGFR; ErbB-1; HER1 in humans) is a member of the receptor tyrosine kinase family and is a transmembrane protein that transduces important growth factor signaling from the extracellular matrix into the cell. Previous reports identified that EGFR is highly expressed in most NSCLC tumors, and its activation and mutation can result in cancer.[3],[4],[5] Therefore, EGFR is an important therapeutic target for lung cancer. Many tyrosine kinase inhibitors that target EGFR have been developed as drugs for NSCLC treatment, such as erlotinib and gefitinib.[6]

Recent studies suggested that cancer stem cells (CSCs) contribute to relapses after chemotherapeutic treatment for lung cancer.[7],[8] CSCs comprise a tumor subpopulation responsible for tumor maintenance, resistance to traditional chemotherapy and radiotherapy,[9] and the development of new tumors.[10] Identification and isolation of CSCs from tissue and tumor cell lines will provide invaluable cell populations for studying their origin and mechanisms for CSC establishment, maintenance, and molecular alterations, when compared with normal cells. This will also provide a tool for developing CSC-specific targeted therapies and increase the survival rates of cancer patients. Identification of CSCs is usually performed using cell surface markers, and several CSC markers have been described, including CD133, CD44, CD24, CD90, CD26, CD34, NANOG, OCT4, SOX2, and aldehyde dehydrogenase 1.[11],[12],[13],[14],[15] Another way to identify CSCs in solid tumors is with the expulsion of Hoechst 33342 dye within a side population (SP) due to the presence of efflux pumps in these cells.[16] In addition, CSCs can be characterized by their ability to grow as spheres in serum-free medium.[17] MicroRNAs (miRNAs) are small noncoding RNAs containing approximately 22 nucleotides that can inhibit messenger RNA (mRNA) translation and/or negatively regulate mRNA stability.[18] Several miRNAs are oncogenes (oncomiRs) that have been identified within lung cancer, including miR-17-92,[19] miR-21,[20] miR-221, and miR-222.[21] Furthermore, several miRNAs have been validated as diagnostic markers, such as miR-25, miR-223, miR-21, miR-126, miR-210, and miR-486-5p.[22],[23] This suggests that miRNAs are important factors that contribute to cancer development. In addition, miRNAs may be potential targets for lung cancer therapy for eliminating lung cancer CSCs. Hence, in this study, we found a CSC marker in H1650 (NSCLC cell line) and a miRNA which are highly expressed in H1650 CSCs and regulate cancer development in H1650.


 > Materials and Methods Top


Cell culture and reagents

Lung cancer cell lines were seeded and grown in 1640 medium with 10% fetal bovine serum (FBS), 100 units/ml of penicillin, 100 μg/ml of streptomycin, and cultured at 37°C in a humidified incubator with 5% CO2.

miR-27a was cloned to PLKO.1 and produced a lentivirus by transfecting 293FT with packaging plasmids. H1650 cell lines were infected with this virus and PLKO.1ctrl virus, and then selected by 1 μg/ml of puromycin to produce H1650 miR-27a and PLKO.1 cell lines.

Doxorubicin (Sigma) was dissolved in dimethyl sulfoxide (DMSO) (Sigma). The drug was diluted in culture media and used at the various concentrations indicated.

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay

H1650 miR-27a and PLKO.1 cells were plated (4,000 live cells) in 96-well plates. Then, the cells were incubated with 0.5 mg/ml of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) and resuspended in 150 μl of DMSO (Sigma) on days 1–5. Absorbance was recorded at 570 nm with experiments repeated for six times.

In vitro scratch test

H1650 miR-27a and PLKO.1 cells were plated (200,000 live cells) and allowed to grow to 80–90% in 6-well tissue culture plates. A 200 ml tip was used to introduce a scratch in the monolayer. Cells were grown in 1640 medium with 2% FBS, 100 units/ml of penicillin, 100 μg/ml of streptomycin, and cultured at 37°C in a humidified incubator with 5% CO2.

The wells were washed with phosphate-buffered saline (PBS) and imaged with an Olympus microscope at 0 and 24 h postscratch. Scratch healing was determined by measuring the shortest distance between the scratch edges in each field of view. At least three different fields were measured per scratch.

Transwell chamber invasion assay

For the Transwell chamber invasion assay, chambers were coated and hydrated. Then, a 0.5 ml suspension of H1650 miR-27a and PLKO.1 cells (25,000 live cells) in serum-free media were added to Transwell 8 mm polycarbonate membrane inserts (Corning) placed in 24-well plates containing 0.75 ml of 10% FBS-containing media. Plates were incubated for 16 h at 37°C. At the end of the incubation period, non-invasion cells on the inside of the filter were removed with a cotton swab, and the filters were fixed with methanol and stained with crystal violet. Following staining, filters were removed from the inserts and mounted on slides for imaging and quantification. The number of invasion cells on the underside of the filter was determined by counting cells in five random fields.

CD133+ CD34 and CD133 CD34+ cell isolation

CD133+ CD34 and CD133 CD34+ cells were isolated using protocols from the CD133 MicroBead Kit and CD34 MicroBead Kit (Miltenyi Biotec, Germany).

Animal xenograft studies

Xenograft tumor studies were conducted as previously described.[24] Briefly, severe combined immunodeficiency (SCID) mice (4–6 weeks old) were purchased from the Shanghai SLAC laboratory animal company. Animals were given time to adapt to the sterile- and pathogen-free environment with food and water ad libitum. CD133+ CD34 and CD133 CD34+ cells were isolated according to the manufacturer's manual. Viable cells of an indicated number in 50 μl of sterile PBS suspensions were mixed with 100 μl of reduced growth factor Matrigel (BD Biosciences, USA) and injected bilaterally and subcutaneously into SCID mice. On day 42 postcell injection, animals were euthanized by cervical dislocation, and tumors were removed and weighed.

H1650 PLKO.1 and H1650 miR-27a cells were harvested in the exponential growth phase using a PBS/ethylenediaminetetraacetic acid solution and washed. Viable cells of an indicated number in 50 μl of sterile PBS suspension were mixed with 100 μl reduced growth factor Matrigel (BD Biosciences, USA) and injected subcutaneously into the SCID mice. On day 21 postcell injection, tumor size was measured with a digital caliper and calculated using the formula: 4/3πLS2 (L = larger radius, S = smaller radius).

Flow cytometry

H1650 cells were trypsinized and pretreated with Dulbecco's modified Eagle medium containing 2% fetal calf serum (staining medium) for 10 min at 37°C. The cells were labeled in the same medium at 37°C for 90 min with 2.5 μg/ml Hoechst 33342 dye (molecular probes), either alone or in combination with 50 μM of verapamil (Sigma), which is an inhibitor of several verapamil-sensitive ATP-binding cassette (ABC) transporters.[25]

Finally, cells were counterstained with 1 μg/ml of propidium iodide to label dead cells. Then, 3–5 × 104 cells were analyzed in a FACSVantage fluorescence-activated cell sorter (Becton Dickinson, USA) using a dual wavelength analysis (blue, 424–444 nm; red, 675 nm) after excitation with 350 nm ultraviolet light. Propidium iodide-positive dead cells (<15%) were excluded from the analysis. The SP cells or non-SP (NSP) cells were sorted for reverse transcription polymerase chain reaction (RT-PCR) and xenograft assays.

Northern blotting

Total RNA was extracted with TRIzol solution (Invitrogen, USA) according to the manufacturer's instructions. Northern blotting was performed as described by Calin et al.[26] The oligonucleotides used as probes were complementary sequences to mature miRNA: miR-27a: 5′ gcggaacttagccactgtgaa 3′.

Real-time quantitative reverse transcription polymerase chain reaction

RNA samples were obtained using RNA isoplus (TAKARA, Canada) according to the manufacturer's instructions. Complementary DNA was synthesized using the PrimeScript RT reagent kit with genomic DNA eraser (TAKARA, Canada). mRNA levels were determined with the SYBR Premix Ex Taq (Tli RNaseH plus) (TAKARA, Canada) and ABIPRISM 7900HT Sequence Detector (PerkinElmer, USA). For expression studies, the quantitative RT-PCR results were normalized to an internal control (glyceraldehyde 3-phosphate dehydrogenase or actin). Primer sequences are reported in [Table 1]. miR-27a was detected as previously described.[27] Statistical significance (P value) was determined by a two-tailed unpaired Student's t-test using Excel (Microsoft, USA).
Table 1: Reverse transcription polymerase chain reaction primers

Click here to view


Microarray analysis

Total RNA was extracted using RNA isoplus (TAKARA, Canada). RNA quality was assessed by spectrophotometry and denaturing gel electrophoresis. RNA was amplified and labeled using the Agilent Quick Amp labeling kit and hybridized to an Agilent whole genome oligo microarray. Slides were scanned using an Agilent DNA microarray scanner. Data were processed using Feature Extraction Software (Agilent technologies, USA, version 10.5.1.1) and analyzed using Agilent GeneSpring GX (Agilent technologies, USA, version 11.0). Experiments were performed in triplicate.

Preparation of protein extracts and immunoblotting

Cells were lysed in cold lysis buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% TritonX-100) with protease inhibitors (Roche, Switzerland) and phosphatase inhibitors (Roche, Switzerland). Proteins were quantified using the bicinchoninic acid method. Antibodies: Actin (Sigma), poly ADP-ribose polymerase (PARP) (Cell Signaling), EGFR (Santa Cruz), p-ERK (Cell Signaling), AKT (Cell Signaling), p-AKT (Cell Signaling), and tubulin (Cell Signaling).


 > Results Top


CD133 and CD34 are cancer stem cell markers in H1650

To identify the function of miR-27a in H1650 CSCs, we first identified markers associated with CSCs in H1650, a cell line of NSCLC. Previous reports identified that Hoechst 33342 was actively extruded by SP cells in various tissues by verapamil-sensitive ABC transporters.[17] Therefore, we removed the H1650 cells from the culture dishes with trypsin, stained them with the fluorescent dye Hoechst 33342, and treated them with or without verapamil. When treated with verapamil, cell populations decreased greatly as shown by flow cytometry detection [Figure 1]a, indicating that the population was SP. We collected SP populations and analyzed the mRNA expression for several CSC markers, including CD44, CD24, OCT4, CD133, CD34, SOX2, and NANOG [Figure 1]b. OCT4, CD133, SOX2, and NANOG were upregulated in H1650 SP, while CD34 was upregulated in H1650 NSP. In addition, we cultured H1650 in serum-free medium for 1 week to form spheres. Then, we analyzed the mRNA of CD44, CD24, OCT4, CD133, CD34, SOX2, and NANOG. The results demonstrated that sphere cells showed similar trends to SP cells for CD133 and CD34 mRNA levels compared with control cells [Figure 1]c. This suggested that CD133 and CD34 were CSC markers for H1650.
Figure 1: CD13 and CD34 are cancer stem cell markers for H1650 cell lines. (a) H1650 cell lines were labeled with Hoechst 33342 dye and analyzed by flow cytometry before and after treatment with verapamil. (b) Relative expression of stem cell markers in side population and nonside population cells. Data are presented as the mean ± standard deviation (n = 3), **P < 0.005. (c) Relative expression of stem cell markers in parental cells and spheres. Data are presented as the mean ± standard deviation (n = 3), **P < 0.005, ***P < 0.001. (d) CD133+ CD34 and CD133 CD34+ cells were treated with the indicated concentrations of doxorubicin for 24 h.. Concentrations of doxorubicin for 24 h. Cell lysates were analyzed by Western blots with poly ADP-ribose polymerase and tubulin antibodies. (e) CD133+ CD34 and CD133 CD34+ cells were treated with the indicated intensities of γ-irradiation. Cell lysates were analyzed by Western blots with poly ADP-ribose polymerase and tubulin antibodies

Click here to view


H1650 CD133+ CD34 cells display the characteristics of cancer stem cells

To verify that H1650 CD133+ CD34 cells were CSCs, we isolated H1650 CD133+ CD34 cells and H1650 CD133 CD34+ cells using the CD133 MicroBead Kit and CD34 MicroBead Kit (Miltenyi Biotec, Germany). CSCs are known to have a strong drug resistance. Doxorubicin is one of the most important anticancer drugs[28] and it induces apoptosis via the activation of caspases and by disrupting mitochondrial membrane potential.[29] First, H1650 CD133+ CD34 and H1650 CD133 CD34+ cells were treated with the indicated concentrations of doxorubicin for 24 h, and then the cleaved PARP in H1650 CD133 CD34+ was dramatically increased by doxorubicin concentration. In contrast, no obvious increases in cleaved PARP in H1650 CD133+ CD34 cells were observed when treated with doxorubicin with the same concentrations [Figure 1]d. This demonstrated that H1650 CD133+ CD34 cells displayed antidrug abilities. Moreover, we treated cells with γ-irradiation (0, 1, 2 Gy). Western blot analyses showed a rapid rise of apoptosis in H1650 CD133 CD34+ cells rather than H1650 CD133+ CD34 cells [Figure 1]e, indicating that H1650 CD133+ CD34 cells had a stronger ability for resistance to traditional radiotherapy. To better elucidate CSC characteristics in H1650 CD133+ CD34 cells, we bilaterally inoculated SCID mice with 104 SP or NSP cells. Tumor growth was measured after 21 days. As shown in [Table 2], only 2/6 mice with NSP cells had a tumor while all the mice with SP cells had tumors. SP cells showed stronger proliferation abilities according to the increased weight of tumors compared with NSP cells, which indicated that SP cells had characteristics similar to CSCs, self-renewing and differentiation capabilities. Furthermore, we subcutaneously inoculated SCID mice with 500 cells of CD133 CD34, CD133+ CD34, CD133 CD34+, and CD133+ CD34+. All of those cells could initiate tumor formation; however, the frequency of tumor formation and tumor weight by CD133+ CD34 cells was significantly higher than the other cells. There was no significant difference between CD133 CD34 and CD133 CD34+ cells, which had the lowest tumor growth rate and tumor weight [Table 3]. These data suggested that H1650 CD133+ CD34 cells had higher capabilities of self-renewal and differentiation among the four kinds of cells, indicating that H1650 CD133+ CD34 cells are the CSCs.
Table 2: Self-renewal of side population

Click here to view
Table 3: Self-renewal of CD133+CD34-

Click here to view


miR-27a is highly expressed in H1650 and HCC827 CD133+ CD34 cells

Previous investigations have shown that miRNA dysregulation is associated with cancer initiation.[30] However, little is known about the function of miRNAs in CSCs. To determine miRNA profiles in CSCs, we isolated CD133+ CD34 and CD133 CD34+ cells from H1650 and HCC827 and conducted a high throughput array for miRNA expression. We identified 43 miRNAs in H1650 and 28 miRNAs in HCC827 that were highly expressed in CD133+ CD34 cells rather than CD133 CD34+ cells (P < 0.05). Among them, 10 miRNAs were both highly expressed in H1650 and HCC827 CD133+ CD34 cells, including miR-27a, miR-101, miR-107, miR-133b, miR-32, miR-339, miR-340, miR-449, miR-489, and miR-629 [Figure 2]a. We searched literature reports for these miRNAs and analyzed their functions in cancer. We selected three miRNAs for further analysis, and only miR-27a expression could be repeated. In addition, we validated the high expression of miR-27a in CD133+ CD34 cells, rather than CD133 CD34+ cells, using RT-PCR [Figure 2]b and Northern blotting [Figure 2]c.
Figure 2: miR-27a is highly expressed in H1650 and HCC827 CD133+ CD34 cells. (a) Representation of microRNA expression upregulated in CD133+ CD34 H1650 and HCC827 cells with microarray. (b) Confirmation of miR-27a expression in CD133+ CD34 cells with reverse transcription polymerase chain reaction. Data are presented as the mean ± standard deviation (n = 3), ***P < 0.001. (c) Northern blots of miR-27a in H1650 CD133 CD34+ and H1650 CD133+ CD34 cells

Click here to view


miR-27a regulates the proliferation, migration, and invasion of H1650

We next explored the role of miR-27a in H1650 proliferation, migration, and invasion. We established a miR-27a-overexpressed H1650 stable cell line (H1650 miR-27a) and control cell line (H1650 PLKO.1). Then, we performed a MTT assay to determine the function of miR-27a in cell proliferation. As shown in [Figure 3]a, cell proliferation was increased in H1650 miR-27a compared with H1650 PLKO.1. To better elucidate the effects of miR-27a in lung cancer proliferation, we subcutaneously inoculated SCID mice with 105 H1650 PLKO.1 or H1650 miR-27a cells. After 21 days, H1650 miR-27a cells resulted in a significant increase in tumor volume compared with H1650 PLKO.1 cells [Figure 3]b.In vitro scratch tests of H1650 PLKO.1 and H1650 miR-27a cells showed that H1650 miR-27a increased cell migration, shown by an approximate 40% delay in wound healing at 24 h [Figure 3]c. To determine whether miR-27a was involved in lung cancer invasion, we performed a Transwell chamber assay. As shown in [Figure 3]d, H1650 miR-27a cells had a strong increase in cell invasion. All these studies demonstrated that miR-27a significantly enhanced proliferation, migration, and invasion of H1650.
Figure 3: Role of miR-27a in H1650 proliferation, migration, and invasion. (a) Growth curves of H1650 PLKO.1 and H1650 miR-27a cell lines by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. (b) Xenografts of H1650 miR-27a cells showing increased growth compared with H1650 PLKO.1 cells on day 21. (c) Scratch tests analyzed at 0 or 24 h in H1650 PLKO.1 and H1650 miR-27a cell lines. Data are presented as the mean ± standard deviation (n = 3). (d) Transwell invasion assay of H1650 PLKO.1 and H1650 miR-27a cells. Data are presented as the mean ± standard deviation (n = 5), ***P < 0.001

Click here to view


miR-27a was associated with epidermal growth factor receptor in non-small cell lung cancer cell lines

Previous investigations have shown that EGFR is important in lung cancer.[31],[32] To determine whether miR-27a was associated with EGFR, we analyzed the expression of miR-27a and EGFR in several lung cancer cell lines using RT-PCR and Western blots, respectively. The results showed that miR-27a was positively correlated with EGFR in most NSCLC cell lines, but not all NSCLC cell lines, because EGFR is not only regulated by miR-27a [Figure 4]a and [Figure 4]b. AKT and ERK are known to be activated by EGFR signaling.[33] To verify that miR-27a was associated with EGFR, we examined the protein level of EGFR and phosphorylation levels of AKT and ERK in H1650 PLKO.1 and H1650 miR-27a cells. The results suggested that the protein level of EGFR and phosphorylation levels of AKT and ERK were increased in H1650 miR-27a compared with H1650 PLKO.1 cells [Figure 4]c. In addition, we subcutaneously inoculated SCID mice with 105 H1650 PLKO.1 and H1650 miR-27a cells and harvested tumors after 3 weeks for Western blot analysis, and similar results were obtained [Figure 4]d. All data indicated that miR-27a enhanced EGFR signaling in H1650.
Figure 4: miR-27a was associated with epidermal growth factor receptor in non-small cell lung cancer cell lines. (a) Relative expression of miR-27a in lung cancer cell lines detected by reverse transcription polymerase chain reaction. (b) Relative expression of epidermal growth factor receptor in lung cancer cell lines detected by Western blots. (c) Epidermal growth factor receptor signaling was upregulated in the H1650 miR-27a cell line and detected by phosphorylation of AKT and ERK. (d) Severe combined immunodeficiency mice were injected subcutaneously with H1650 PLKO.1 and H1650 miR-27a cells. After 3 weeks, tumors were harvested and identified with Western blots. Epidermal growth factor receptors, p-ERK and p-AKT, were upregulated in tumors formed by H1650 miR-27a

Click here to view



 > Discussion Top


CSCs are potentially extremely important because they are responsible for tumor recurrence after chemotherapy and radiotherapy. These cells must be eliminated for curative cancer therapy, and therefore, it is important to isolate and study CSCs and identify CSC markers.

In this study, we validated that CD133+ CD34 is a marker for H1650 CSCs. We provided evidence that H1650 CD133+ CD34 cells showed drug resistance to doxorubicin. We also demonstrated that H1650 CD133+ CD34 cells displayed an increase in cellular viability compared with H1650 CD133 CD34+ cells when treated with γ-irradiation. We performed xenograft tumor studies and found that H1650 CD133+ CD34 cells had a stronger ability for tumor initiation and tumor growth. Our observations were consistent with previous reports that CD133 is a CSC marker and commonly used for CSC selection.[34] We refined CSC from CD133+ cells. This population is more aggressive than CD133+ only.

Previous studies have shown that miR-27a can promote cancer development[35],[36] and drug resistance.[37] In addition, miR-27a expression is upregulated in breast cancer[38] and downregulated in colorectal cancer and oral squamous carcinoma.[20],[39] Furthermore, miR-27a is significantly upregulated in cisplatin-resistant lung AC A549/CDDP cells compared with parental A549 cells[37] and downregulated in sphere-forming cells for three SCLC cell lines.[40] In this study, we demonstrated that miR-27a contributes to cancer proliferation, migration, and invasion in H1650 cell lines. We showed that miR-27a was positively correlated with EGFR in lung cancer cell lines. We also demonstrated that miR-27a upregulated EGFR expression and activated AKT and ERK in H1650 and xenograft tumor cells.

These findings lead to a better understanding of CSCs and provide additional strategies for future lung cancer therapies.

Financial support and sponsorship

This work was supported by grants from the Ministry of Science and Technology of China (973 Program; 2014 CB910500 and 2011 CB910900), the National Natural Science Foundation of China (81172231), and the Chinese Academy of Sciences (Hundred Talents Program No. 2010 OHTP07) for Zhixue Liu.

Conflicts of interest

There are no conflicts of interest.



 
 > References Top

1.
Novaes FT, Cataneo DC, Ruiz Junior RL, Defaveri J, Michelin OC, Cataneo AJ. Lung cancer: Histology, staging, treatment and survival. J Bras Pneumol 2008;34:595-600.  Back to cited text no. 1
    
2.
Youlden DR, Cramb SM, Baade PD. The international epidemiology of lung cancer: Geographical distribution and secular trends. J Thorac Oncol 2008;3:819-31.  Back to cited text no. 2
    
3.
Scagliotti GV, Selvaggi G, Novello S, Hirsch FR. The biology of epidermal growth factor receptor in lung cancer. Clin Cancer Res 2004;10(12 Pt 2):4227s-32s.  Back to cited text no. 3
    
4.
Zhang H, Berezov A, Wang Q, Zhang G, Drebin J, Murali R, et al. ErbB receptors: From oncogenes to targeted cancer therapies. J Clin Invest 2007;117:2051-8.  Back to cited text no. 4
    
5.
Wen Q, Wang W, Chu S, Luo J, Chen L, Xie G, et al. Flot-2 expression correlates with EGFR levels and poor prognosis in surgically resected non-small cell lung cancer. PLoS One 2015;10:e0132190.  Back to cited text no. 5
    
6.
da Cunha Santos G, Shepherd FA, Tsao MS. EGFR mutations and lung cancer. Annu Rev Pathol 2011;6:49-69.  Back to cited text no. 6
    
7.
Giangreco A, Arwert EN, Rosewell IR, Snyder J, Watt FM, Stripp BR. Stem cells are dispensable for lung homeostasis but restore airways after injury. Proc Natl Acad Sci U S A 2009;106:9286-91.  Back to cited text no. 7
    
8.
Giangreco A, Groot KR, Janes SM. Lung cancer and lung stem cells: Strange bedfellows? Am J Respir Crit Care Med 2007;175:547-53.  Back to cited text no. 8
    
9.
Dean M, Fojo T, Bates S. Tumour stem cells and drug resistance. Nat Rev Cancer 2005;5:275-84.  Back to cited text no. 9
    
10.
Dalerba P, Dylla SJ, Park IK, Liu R, Wang X, Cho RW, et al. Phenotypic characterization of human colorectal cancer stem cells. Proc Natl Acad Sci U S A 2007;104:10158-63.  Back to cited text no. 10
    
11.
Visvader JE, Lindeman GJ. Cancer stem cells in solid tumours: Accumulating evidence and unresolved questions. Nat Rev Cancer 2008;8:755-68.  Back to cited text no. 11
    
12.
Lohberger B, Rinner B, Stuendl N, Absenger M, Liegl-Atzwanger B, Walzer SM, et al. Aldehyde dehydrogenase 1, a potential marker for cancer stem cells in human sarcoma. PLoS One 2012;7:e43664.  Back to cited text no. 12
    
13.
Davies S, Beckenkamp A, Buffon A. CD26 a cancer stem cell marker and therapeutic target. Biomed Pharmacother 2015;71:135-8.  Back to cited text no. 13
    
14.
Park SC, Zeng C, Tschudy-Seney B, Nguyen NT, Eun JR, Zhang Y, et al. Clonogenically culturing and expanding CD34+ liver cancer stem cells in vitro. Stem Cells Dev 2015;24:1506-14.  Back to cited text no. 14
    
15.
Ben-Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, Regev A, et al. An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat Genet 2008;40:499-507.  Back to cited text no. 15
    
16.
Zhou S, Schuetz JD, Bunting KD, Colapietro AM, Sampath J, Morris JJ, et al. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nat Med 2001;7:1028-34.  Back to cited text no. 16
    
17.
Kondo T, Setoguchi T, Taga T. Persistence of a small subpopulation of cancer stem-like cells in the C6 glioma cell line. Proc Natl Acad Sci U S A 2004;101:781-6.  Back to cited text no. 17
    
18.
Ambros V. The functions of animal microRNAs. Nature 2004;431:350-5.  Back to cited text no. 18
    
19.
Olive V, Jiang I, He L. mir-17-92, a cluster of miRNAs in the midst of the cancer network. Int J Biochem Cell Biol 2010;42:1348-54.  Back to cited text no. 19
    
20.
Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 2006;103:2257-61.  Back to cited text no. 20
    
21.
Garofalo M, Di Leva G, Romano G, Nuovo G, Suh SS, Ngankeu A, et al. miR-221 and 222 regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation. Cancer Cell 2009;16:498-509.  Back to cited text no. 21
    
22.
Chen X, Ba Y, Ma L, Cai X, Yin Y, Wang K, et al. Characterization of microRNAs in serum: A novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res 2008;18:997-1006.  Back to cited text no. 22
    
23.
Shen J, Todd NW, Zhang H, Yu L, Lingxiao X, Mei Y, et al. Plasma microRNAs as potential biomarkers for non-small-cell lung cancer. Lab Invest 2011;91:579-87.  Back to cited text no. 23
    
24.
Rhodes LV, Muir SE, Elliott S, Guillot LM, Antoon JW, Penfornis P, et al. Adult human mesenchymal stem cells enhance breast tumorigenesis and promote hormone independence. Breast Cancer Res Treat 2010;121:293-300.  Back to cited text no. 24
    
25.
Goodell MA, Brose K, Paradis G, Conner AS, Mulligan RC. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 1996;183:1797-806.  Back to cited text no. 25
    
26.
Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, et al. Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 2002;99:15524-9.  Back to cited text no. 26
    
27.
Varkonyi-Gasic E, Wu R, Wood M, Walton EF, Hellens RP. Protocol: A highly sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods 2007;3:12.  Back to cited text no. 27
    
28.
Ezquer F, Gutiérrez J, Ezquer M, Caglevic C, Salgado HC, Calligaris SD. Mesenchymal stem cell therapy for doxorubicin cardiomyopathy: Hopes and fears. Stem Cell Res Ther 2015;6:116.  Back to cited text no. 28
    
29.
Gamen S, Anel A, Pérez-Galán P, Lasierra P, Johnson D, Piñeiro A, et al. Doxorubicin treatment activates a Z-VAD-sensitive caspase, which causes deltapsim loss, caspase-9 activity, and apoptosis in Jurkat cells. Exp Cell Res 2000;258:223-35.  Back to cited text no. 29
    
30.
Croce CM. Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet 2009;10:704-14.  Back to cited text no. 30
    
31.
Pao W, Miller V, Zakowski M, Doherty J, Politi K, Sarkaria I, et al. EGF receptor gene mutations are common in lung cancers from “never smokers” and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 2004;101:13306-11.  Back to cited text no. 31
    
32.
Paez JG, Jänne PA, Lee JC, Tracy S, Greulich H, Gabriel S, et al. EGFR mutations in lung cancer: Correlation with clinical response to gefitinib therapy. Science 2004;304:1497-500.  Back to cited text no. 32
    
33.
Gan Y, Shi C, Inge L, Hibner M, Balducci J, Huang Y. Differential roles of ERK and Akt pathways in regulation of EGFR-mediated signaling and motility in prostate cancer cells. Oncogene 2010;29:4947-58.  Back to cited text no. 33
    
34.
Tirino V, Desiderio V, Paino F, De Rosa A, Papaccio F, La Noce M, et al. Cancer stem cells in solid tumors: An overview and new approaches for their isolation and characterization. FASEB J 2013;27:13-24.  Back to cited text no. 34
    
35.
Mertens-Talcott SU, Chintharlapalli S, Li X, Safe S. The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells. Cancer Res 2007;67:11001-11.  Back to cited text no. 35
    
36.
Liu T, Tang H, Lang Y, Liu M, Li X. MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin. Cancer Lett 2009;273:233-42.  Back to cited text no. 36
    
37.
Li J, Wang Y, Song Y, Fu Z, Yu W. miR-27a regulates cisplatin resistance and metastasis by targeting RKIP in human lung adenocarcinoma cells. Mol Cancer 2014;13:193.  Back to cited text no. 37
    
38.
Guttilla IK, White BA. Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J Biol Chem 2009;284:23204-16.  Back to cited text no. 38
    
39.
Kozaki K, Imoto I, Mogi S, Omura K, Inazawa J. Exploration of tumor-suppressive microRNAs silenced by DNA hypermethylation in oral cancer. Cancer Res 2008;68:2094-105.  Back to cited text no. 39
    
40.
Miao Y, Li J, Qiu X, Li Y, Wang Z, Luan Y. miR-27a regulates the self renewal of the H446 small cell lung cancer cell line in vitro. Oncol Rep 2013;29:161-8.  Back to cited text no. 40
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Article Figures>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed1184    
    Printed55    
    Emailed0    
    PDF Downloaded52    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]