Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2018  |  Volume : 14  |  Issue : 10  |  Page : 767-773

Four-and-a-half LIM protein 1 promotes paclitaxel resistance in hepatic carcinoma cells through the regulation of caspase-3 activation


1 Department of Medical Oncology, Capital Medical University Cancer Center, Beijing Shijitan Hospital, Beijing 100038, P.R. China
2 Department of Medical Molecular Biology, Beijing Institute of Biotechnology, Beijing 100850, P.R. China
3 Department of Microbial and Biochemical Pharmacy, School of Pharmaccutical Science, Jilin University, Changchun 130021, P.R. China

Date of Web Publication24-Sep-2018

Correspondence Address:
Jun Ren
Department of Medical Oncology, Capital Medical University Cancer Center, Beijing Shijitan Hospital, Beijing 100038
P.R. China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0973-1482.187304

Rights and Permissions
 > Abstract 


Background: Hepatocellular carcinoma (HCC) is the third leading cause of cancer deaths worldwide.
Aim: To investigate the mechanisms of paclitaxel resistance in hepatocellular carcinoma cells and find promising molecular target for HCC therapy.
Materials and Methods: To investigate the effects of FHL1 on chemo resistance in HCC cells, we generated FHL1 knock-down stable cell lines with HepG2 and SMMC7721 cells. Cell viability assay, colony formation and xenograft experiments assay were performed to detect effect of FHL1 on Paclitaxel or Oxaliplatin resistance in vitro and in vivo. Caspase activity assay was performed to explore the activation of caspase-3 and caspase-9 in paclitaxel treated FHL1-knockdown HepG2 cells.
Result: In the present study we have investigated that four-and-a-half LIM protein 1 (FHL1), which plays an important role in the development of cancer, is associated with both the chemo resistance of hepatocellular carcinomas cells in vitro and in vivo. Knockdown of FHL1 significantly enhanced the sensitivity of paclitaxel, but had no effects on sensitivity of oxaliplatin. Moreover, knockdown of FHL1 promoted the activation of caspase-3 and caspase-9, which were induced by paclitaxel. Interestingly, FHL1 negatively regulates the chemo resistance of HCC in xenografted nude mice.
Conclusion: FHL1 promote paclitaxel resistance in hepatocellular carcinomas cells through regulating apoptosis induced by paclitaxel, suggesting that FHL1 may be a promising molecular target for HCC therapy.

Keywords: Caspase-3, drug resistance, four-and-a-half LIM protein 1, paclitaxel


How to cite this article:
Zhou L, Ding L, Liu J, Zhang Y, Luo X, Zhao L, Ren J. Four-and-a-half LIM protein 1 promotes paclitaxel resistance in hepatic carcinoma cells through the regulation of caspase-3 activation. J Can Res Ther 2018;14, Suppl S3:767-73

How to cite this URL:
Zhou L, Ding L, Liu J, Zhang Y, Luo X, Zhao L, Ren J. Four-and-a-half LIM protein 1 promotes paclitaxel resistance in hepatic carcinoma cells through the regulation of caspase-3 activation. J Can Res Ther [serial online] 2018 [cited 2019 Sep 17];14:767-73. Available from: http://www.cancerjournal.net/text.asp?2018/14/10/767/187304




 > Introduction Top


Paclitaxel is widely used in the treatment of various cancers, such as ovarian, breast, gastric, and nonsmall-cell lung cancer.[1] Paclitaxel inhibits cell replication by binding to tubulin to enhance polymerization of microtubule bundles, which leads to cell cycle arrest in G2/M phase.[2],[3] This results in cell cycle blockage in mitosis and subsequent activation of an apoptotic pathway. Although it is demonstrated that paclitaxel has antitumor activity against several cancers, drug resistance impedes therapeutic outcome and represents a major obstacle in cancer therapies.[4] Several mechanisms have been implicated in the development of paclitaxel resistance in many human tumors, such as over expression of the multidrug transporter P-glycoprotein encoded by multidrug resistance gene MDR1,[5],[6] alterations in the metabolism of drugs, decreases of death-induced stimuli sensitivity,[7] alterations in microtubule dynamics and mutations that diminish the binding of the drug to cellular targets (microtubule-associated proteins [MAPs]) which contain MAP2, MAP4, Tau, STOP, Mip-90, and statmin.[8],[9],[10] However, the biological effects of paclitaxel on hepatocellular carcinomas (HCCs) are limited. Some researchers have proved that paclitaxel could inhibit the growth of HCC cells and block the cell cycle in the G2/M phase,[11] but the mechanisms are still unclear and further study was warranted.

Four-and-a-half LIM protein 1 (FHL1) belongs to the LIM-only protein family, characterized by four complete LIM domains, preceded by an N-terminal half LIM domain.[12] LIM domains are cysteine-rich zinc finger motifs mediating protein-protein interactions with transcription factors, cell-signaling molecules, and cytoskeleton-associated proteins.[13],[14],[15] FHL1 plays important roles in skeletal and cardiac muscle growth.[16],[17] Recently, FHL1 has been shown to play roles in carcinogenesis.[18],[19] FHL1 expression is down-regulated in various types of malignancies including breast cancer, gastric cancer, lung cancer, prostate cancer, ovary cancer, colon cancer, thyroid cancer, brain tumor, renal cancer, liver cancer, and melanoma.[19],[20],[21],[22],[23],[24] FHL1 is also a tumor suppressor gene that acts downstream of Src and Cas to specifically block mouse cancer cell growth and migration.[25],[26],[27] In our previous study, we showed that FHL1 physically and functionally interacted with Smad2, Smad3, and Smad4, important regulators of cancer development and progression, and suppresses human hepatoma cell growth.[18],[28] However, the detailed mechanism by which FHL1 exerts its tumor suppressive role is still poorly understood.

In this study, we report that FHL1 decreases sensitivity of paclitaxel treatment in HCC in vivo and in vitro, and promotes paclitaxel resistance by regulation of caspase-3 expression and activation.


 > Methods Top


Plasmids, small interfering RNAs, and transfection

The complementary DNA target sequences of small interfering RNAs (siRNAs) for FHL1 was AAGGAGGTGCACTATAAGAAC, and was inserted into pSilencer2.1-U6neo (Ambion). Expression vectors for siRNA-resistant FHL1 were generated by recombinant PCR method, with a silent mutation in the 3′ nucleotide of a codon in the middle of the siRNA binding site. Transfection of the vector based siRNA into HepG2 and SMMC7721 cells (American Type Culture Collection) were performed by lipofectamine 2000 (Invitrogen). For the purpose of stable transfections, transfected cells were selected in 500 μg/ml G418 (Invitrogen) for approximately 1 month. Pooled clones were screened by Western blot.

Cell culture

HepG2/FHL1 siRNA and SMMC7721/FHL1 siRNA, two liver cancer cell lines stably express siRNA against FHL1, and the control cells (HepG2/FHL1 siRNA vector and SMMC7721/FHL1 siRNA vector) were constructed as previously described. Cells were routinely cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS; Hyclone), 100 U/ml penicillin and 100 g/ml streptomycin at 37°C in a humidified atmosphere containing 5% CO2.

Cell viability assay

Cells (5 × 103 cells per well) were seeded in 96-wells plate, and cultured overnight. After treatments of paclitaxel, cells were incubated with the mixed liquor (10 μL Cell Counting Kit-8 reagent + 90 μL RPMI 1640/DMEM medium) at 37°C for 1 h. Then, the value was measured at 450 nm of light absorption.

Western blot analysis

Cellular protein was extracted with 1× cell RIPA buffer. Density of proteins was determined by Pierce BCA Protein Assay Kit. According to the routine, equivalent amounts of protein (30 μg) were loaded onto polyacrylamide gel, electrophoresed, and then transferred onto nitrocellulose NC membranes (Whatman). After blocking, these membranes with odyssey blocking buffer for 1 h, target antigens were reacted with primary antibodies and subsequently secondary antibodies. Finally, the membranes were scanned by the Odyssey infrared imaging system (Li-Cor Biosciences, Santa Clara, CA, USA).

Cell colony formation assay

Cells (1 × 103 cells per well) were plated in 6-well plates (Corning) and treated with paclitaxel (10 nm) for 24 h, and cultured with DMEM containing 10% FBS. Culture medium was replaced every 3 d, and the colonies were fixed in 3 mL of 4% paraformaldehyde for 30 min. Giemsa staining was performed for 20 min, and the cells were washed thrice with PBS. The clone number was counted under a microscope.

Animal treatment

Severe combined immunodeficiency (SCID) mice (aged 4–6 weeks and weighing approximately 20 g) were obtained from the Chinese Academy of Sciences and maintained under standard pathogen-free conditions. All mice were handled in accordance with the recommendations of the National Institutes of Health Guidelines for Care and Use of Laboratory Animals. Twenty SCID mice were randomly allocated into two groups. One group was subcutaneously inoculated with HepG2/FHL1 control cells (1 × 107 cells per mouse) in the right flank, the other group was inoculated with HepG2/FHL1 knockdown cells (1 × 107 cells per mouse). When tumors were palpable 4–6 weeks after the inoculation, half of the mice were treated with 0.1 ml paclitaxel (10 mg/kg, was given via tail vein injection weekly), and the other half was similarly injected with 0.1 ml 5% glucose solution as the control in each group. Tumor size was monitored by measuring length and width with a caliper. Four weeks later, the mice were sacrificed and tumors were dissected out and measured with a caliper. Tumor volume was calculated with the following formula: volume = (longest diameter × shortest dameter2)/2.

Flow cytometry

Annexin V staining was performed as indicated, with the annexin V-fluorescein isothiocyanate apoptosis kit (BioVision). In brief, cells were washed with cold PBS and then resuspended in binding buffer. After 15 min of incubation with annexin V dye, cells were washed and propidium iodide was added. Cells were analyzed by flow cytometry. The results were expressed as the mean of three independent experiments.

Caspase activity assay

Cells were treated with 250 mM Z-VAD-FMK (BD Pharmingen, San Jose, CA, USA) for 1 h, and the caspase activation was measured using the Caspase-Glo assay (Promega) according to the manufacturer's directions. Briefly, 10 mg of whole-cell lysates was incubated at room temperature in the dark for 1 h with caspase-3 or caspase-9 substrate. Following incubation, luminescence was measured using a TD-20/20 luminometer. The amount of luminescence detected as relative light units was proportional to caspase activity.

Statistical analysis

Statistical analyses were performed using SPSS software 17.0 (Statistical Product and Service Solutions, IBM, NY, USA) for Windows. Comparison between groups was performed by one-way analysis of variance followed by post hoc multiple pair wise comparison using Tukey's test to determine the statistical difference. P <0.05 was considered statistically significant.


 > Results Top


Four-and-a-half LIM protein 1 increases viability of hepatic carcinoma cells treated with paclitaxel

To investigate the effects of FHL1 on chemoresistance in HCC cells, we generated two stable cell lines by transfecting the vector based siRNA into HepG2 and SMMC7721, respectively. Knockdown efficiency was tested by Western blot. As shown in [Figure 1]a, expression of FHL1 in stable FHL1-knockdown HepG2 was inhibited by a level at 80% at least compared to the control stable cell line, and it could be rescued by FHL1 rescue plasmid. Knockdown efficiency of FHL1 in stable FHL1-knockdown SMMC7721 was even higher than that in stable FHL1-knockdown HepG2, and expression of FHL1 could also be rescued by FHL1 rescue plasmid (data not shown). Interestingly, knockdown of FHL1 promoted cell proliferation of stable FHL1-knockdown HepG2 [Figure 1]b and SMMC7721 (data not shown), whereas the rescue of FHL1 down-regulated the cell proliferation to the same level as the control stable cell line, indicating that FHL1 itself has a negative regulation effect on cell viability.
Figure 1: Four-and-a-half LIM protein 1 increases viability of hepatic carcinoma cells treated with paclitaxel. (a) HepG2 cells stably expressing four-and-a-half LIM protein 1 small interfering RNA were transiently transfected with small interfering RNA-resistant four-and-a-half LIM protein 1 (four-and-a-half LIM protein 1 rescue). Cell lysates were analyzed by immunoblotting with anti-four-and-a-half LIM protein 1 antibody. The densitometric quantitation of the four-and-a-half LIM protein 1 band normalized to glyceraldehyde 3-phosphate dehydrogenase. (b) The control HepG2, four-and-a-half LIM protein 1-knockdown HepG2 and the rescued cell line were cultured in regular medium. At indicated times, cell viability was determined by Cell Counting Kit-8 cell viability assay. (c and d) Each HepG2 cell line (as mentioned above) was treated with Paclitaxel (c) or oxaliplatin (d). At indicated times, cell viability was determined by Cell Counting Kit-8 cell viability assay. (e and f) Each SMMC7721 cell line (as mentioned above) was treated with paclitaxel (e) or oxaliplatin (f). At indicated times, cell viability was determined by Cell Counting Kit-8 cell viability assay. Values shown are mean ± standared deviation of triplicate measurements and have been repeated three times with similar results. **P < 0.01 versus control small interfering RNA

Click here to view


To further investigate the role of FHL1 on chemoresistance, we treated FHL1-knockdown or rescued HepG2/SMMC7721 with paclitaxel or oxaliplatin, respectively, and cell viability was examined. Knockdown of FHL1 increased the sensitivity to paclitaxel in HepG2, but not oxaliplatin, and this phenotype was restored by rescue [Figure 1]c and [Figure 1]d. Similar results were observed in SMMC7721 [Figure 1]e and [Figure 1]f, suggesting that FHL1 specifically deceases sensitivity to paclitaxel in hepatic carcinoma cells.

Four-and-a-half LIM protein 1 promotes anchorage-independent growth of hepatic carcinoma cells treated with paclitaxel

To examine the effect of FHL1 on anchorage-independent growth of hepatic carcinoma cells treated with paclitaxel, colony formation assay was performed using stable HepG2 cell lines expressing FHL1 siRNA. Knockdown of FHL1 inhibited the anchorage-independent growth of stable HepG2 cell line treated with paclitaxel [Figure 2]a and [Figure 2]b, which means knockdown of FHL1 caused the cells susceptible to paclitaxel-induced cell death, whereas the control and the rescued cells remained relatively resistant. Similar results were observed in SMMC7721 cells [Figure 2]c and [Figure 2]d. These data suggest FHL1 promotes paclitaxel resistance in hepatic carcinoma cells.
Figure 2: Four-and-a-half LIM protein 1 promotes anchorage-independent growth of hepatic carcinoma cells treated with paclitaxel. (a and b) The control HepG2, four-and-a-half LIM protein 1-knockdown HepG2 and the rescued cell line were plated and assayed for colony number after 3 weeks. Colonies on plates were shown in the photographs (a). Colony numbers were determined by crystal violet assay (b). (c and d) The control SMMC7721, four-and-a-half LIM protein 1-knockdown SMMC7721 and the rescued cell line were plated and assayed for colony number after 3 weeks. Colonies on plates were shown in the photographs (c). Colony numbers were determined by crystal violet assay (d). Values shown are mean ± standard deviation of triplicate measurements and have been repeated three times with similar results. P value is as indicated

Click here to view


Four-and-a-half LIM protein 1 promotes tumor growth in nude mice treated with paclitaxel

To further verify paclitaxel resistance induced by FHL1, we performed xenograft experiments in vivo. Consistently, tumors in FHL1-knockdown mice FHL1 grew faster than that in control mice, suggesting FHL1 itself may function as a negative regulation factor of tumors in vivo [Figure 3]a and [Figure 3]b. Paclitaxel inhibited more effectively the growth rate of tumors with FHL1 knockdown in BALB/c nude mice than the control tumors in the mice [Figure 3]a and [Figure 3]b. Taken together, our data indicate that FHL1 has a major role in the drug resistance of HCC cells to the treatment of paclitaxel.
Figure 3: Four-and-a-half LIM protein 1 promotes tumor growth in nude mice treated with paclitaxel. (a) HepG2 cells stably expressing control or four-and-a-half LIM protein 1 small interfering RNA were injected into nude mice (n = 10 in each group). The mice were treated with paclitaxel or glucose solution (n = 10 in each group). Tumor size was measured using a caliper. Tumor volume was calculated with the following formula: V = L2 × D/2. (b) Quantification of tumor volume in Figure 3a

Click here to view


Knockdown of four-and-a-half LIM protein 1 promotes sensitivity to paclitaxel through activation of caspase-3

To explore the mechanism of paclitaxel resistance induced by FHL1, we examined the apoptosis percentage of FHL1-knockdown HepG2 cells with or without treatment of paclitaxel. All cell lines were pretreated with or without the broad-spectrum caspase inhibitor (Z-VAD-FMK) before the treatment of paclitaxel. As shown in [Figure 4]a, paclitaxel-triggered apoptosis was higher in FHL1-knockdown HepG2 than the control cell line, and Z-VAD-FMK treatment resulted in a complete reversal of paclitaxel-induced apoptosis in both cell lines [Figure 4]a, suggesting FHL1 may functions as a negative regulation factor of cell apoptosis.
Figure 4: Knockdown of four-and-a-half LIM protein 1 promotes sensitivity to paclitaxel through activation of caspase-3. (a-c) HepG2 cell stably expressing control or four-and-a-half LIM protein 1 small interfering RNA were treated with 250 mM Z-VAD-FMK for 1 h after stimulation with paclitaxel for indicated time. The presence of apoptosis was assessed by FITC-labeled annexin V staining and flow cytometry (a). Expression of caspase-3/9 was examined by Western blot. Glyceraldehyde 3-phosphate dehydrogenase was used as a loading control (b). Caspase-3 activation was measured using the Caspase-Glo assay (c). Values shown are mean ± standard deviation of triplicate measurements and have been repeated three times with similar results

Click here to view


To further delineate the mechanism of FHL1-mediated paclitaxel resistance, caspase-3 and caspase-9 protein level in FHL1-knockdown HepG2 cells with or without the treatment of paclitaxel was examined. Expression of FHL1-specific siRNA, but not control siRNA, increased caspase-3/9 abundance in HepG2 cells [Figure 4]b. Paclitaxel increased caspase-3/9 expression in the control cells, while the upregulation expression was even higher in FHL1-knockdown HepG2 [Figure 4]b, suggesting that FHL1 may play a role in the inhibition of capsase-3/9 expression. Coincidently, the capase-3 activity also increased in FHL1-knockdown HepG2 cells, compared to the control cell line, and it could be inhibited by Z-VAD-FMK [Figure 4]c. These results indicate that FHL1 promotes paclitaxel resistance by a mechanism involving the FHL1-mediated inhibition of caspase-3.


 > Discussion Top


Paclitaxel stabilizes the dynamics of microtubule, arrests mitosis at metaphase through the activation of the spindle checkpoint and induces cell apoptosis.[29],[30] HCC generally has shown the characteristics of chemoresistance to antitumor agents by multiple mechanisms, such as tubulin mutations, variable expression of tubulin isoforms, overexpression of multi-drug resistance transporters, and bcl-2.[31],[32] In HCC cell lines and tissues, overexpression of anti-apoptotic survivin also provides an alternative mechanism to explain the resistance to paclitaxel.[33] However, the effect of paclitaxel on HCCs at the molecular and cellular levels has never been adequately addressed. This may be explained by the fact that there are various alternate mechanisms of resistance controlled by different families of genes. Whereas these alternative pathways could influence drug resistance, leading to diminished cell killed by chemotherapeutic drugs, the effector molecules are poorly understood, and their relative contribution in disease remains to be elucidated. Therefore, there is a need to develop new anticancer drugs and novel regimens that are capable of killing drug-resistant cells. In this study, we demonstrate that downregulation of FHL1 expression in HCC cells rendered these cells more sensitive to paclitaxel than oxaliplatin. First, paclitaxel resistance of HCC cells showed an inverse relationship with the FHL1 levels. Second, paclitaxel resistance of HCC cells with low caspase-3 and caspase-9 expression. Thus, the data presented here highlight the importance of FHL1 as a molecular marker for directing paclitaxel efficacy in HCC.

Paclitaxel play its role through the proliferation difference of tumor and normal cells. Therefore, high proliferation cells are more sensitive to paclitaxel. FHL1 knock-down in HepG2 cell promoted cell proliferation, which is probably one of the reasons that FHL1 knock-down cells are much more sensitive to paclitaxel. In common, high cell viability usually has stronger anti-apoptosis capacity. Therefore, it is interesting to detect whether FHL1 knock-down induces anti-apoptosis.

Whereas FHL1 is a promising single gene marker of sensitivity to paclitaxel-containing chemotherapy, it is also clear that many tumors, despite with low FHL1 expression, are not fully sensitive to treatment, suggesting additional pathways of resistance. This observation is consistent with the commonly held belief that response to chemotherapy is a multifactorial process and that no single marker will be informative in all cases. Multi-gene predictors that use information from several distinct molecular pathways of resistance will likely be more powerful than any single gene. However, low FHL1 expression represents a unique molecular mechanism of hypersensitivity to paclitaxel. Inhibition of FHL1 function could be explored as a potential therapeutic strategy to increase the anticancer activity of this drug.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
 > References Top

1.
Montana M, Ducros C, Verhaeghe P, Terme T, Vanelle P, Rathelot P. Albumin-bound paclitaxel: The benefit of this new formulation in the treatment of various cancers. J Chemother 2011;23:59-66.  Back to cited text no. 1
    
2.
Jordan MA, Wilson L. Microtubules as a target for anticancer drugs. Nat Rev Cancer 2004;4:253-65.  Back to cited text no. 2
    
3.
Wagner P, Wang B, Clark E, Lee H, Rouzier R, Pusztai L. Microtubule Associated Protein (MAP)-Tau: A novel mediator of paclitaxel sensitivity in vitro and in vivo. Cell Cycle 2005;4:1149-52.  Back to cited text no. 3
    
4.
Ingemarsdotter CK, Tookman LA, Browne A, Pirlo K, Cutts R, Chelela C, et al. Paclitaxel resistance increases oncolytic adenovirus efficacy via upregulated CAR expression and dysfunctional cell cycle control. Mol Oncol 2015;9:791-805.  Back to cited text no. 4
    
5.
Gottesman MM. Mechanisms of cancer drug resistance. Annu Rev Med 2002;53:615-27.  Back to cited text no. 5
    
6.
Wang Y, Chen Q, Jin S, Deng W, Li S, Tong Q, et al. Up-regulation of P-glycoprotein is involved in the increased paclitaxel resistance in human esophageal cancer radioresistant cells. Scand J Gastroenterol 2012;47:802-8.  Back to cited text no. 6
    
7.
Blagosklonny MV, Fojo T. Molecular effects of paclitaxel: Myths and reality (a critical review). Int J Cancer 1999;83:151-6.  Back to cited text no. 7
    
8.
Dumontet C, Sikic BI. Mechanisms of action of and resistance to antitubulin agents: Microtubule dynamics, drug transport, and cell death. J Clin Oncol 1999;17:1061-70.  Back to cited text no. 8
    
9.
Drukman S, Kavallaris M. Microtubule alterations and resistance to tubulin-binding agents (review). Int J Oncol 2002;21:621-8.  Back to cited text no. 9
    
10.
Smoter M, Bodnar L, Duchnowska R, Stec R, Grala B, Szczylik C. The role of Tau protein in resistance to paclitaxel. Cancer Chemother Pharmacol 2011;68:553-7.  Back to cited text no. 10
    
11.
Okano J, Nagahara T, Matsumoto K, Murawaki Y. The growth inhibition of liver cancer cells by paclitaxel and the involvement of extracellular signal-regulated kinase and apoptosis. Oncol Rep 2007;17:1195-200.  Back to cited text no. 11
    
12.
Morgan MJ, Madgwick AJ. The LIM proteins FHL1 and FHL3 are expressed differently in skeletal muscle. Biochem Biophys Res Commun 1999;255:245-50.  Back to cited text no. 12
    
13.
Müller JM, Isele U, Metzger E, Rempel A, Moser M, Pscherer A, et al. FHL2, a novel tissue-specific coactivator of the androgen receptor. EMBO J 2000;19:359-69.  Back to cited text no. 13
    
14.
Coghill ID, Brown S, Cottle DL, McGrath MJ, Robinson PA, Nandurkar HH, et al. FHL3 is an actin-binding protein that regulates alpha-actinin-mediated actin bundling: FHL3 localizes to actin stress fibers and enhances cell spreading and stress fiber disassembly. J Biol Chem 2003;278:24139-52.  Back to cited text no. 14
    
15.
Samson T, Smyth N, Janetzky S, Wendler O, Müller JM, Schüle R, et al. The LIM-only proteins FHL2 and FHL3 interact with alpha- and beta-subunits of the muscle alpha7beta1 integrin receptor. J Biol Chem 2004;279:28641-52.  Back to cited text no. 15
    
16.
Loughna PT, Mason P, Bayol S, Brownson C. The LIM-domain protein FHL1 (SLIM 1) exhibits functional regulation in skeletal muscle. Mol Cell Biol Res Commun 2000;3:136-40.  Back to cited text no. 16
    
17.
Cowling BS, McGrath MJ, Nguyen MA, Cottle DL, Kee AJ, Brown S, et al. Identification of FHL1 as a regulator of skeletal muscle mass: Implications for human myopathy. J Cell Biol 2008;183:1033-48.  Back to cited text no. 17
    
18.
Ding L, Niu C, Zheng Y, Xiong Z, Liu Y, Lin J, et al. FHL1 interacts with oestrogen receptors and regulates breast cancer cell growth. J Cell Mol Med 2011;15:72-85.  Back to cited text no. 18
    
19.
Fan Z, Xu X, Zhang X, Wang T, Han B, Liang Y, et al. FHL1 knockdown mediated by lentiviral shRNA promotes the growth of HeLa and HepG2 cells. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 2015;31:879-83.  Back to cited text no. 19
    
20.
Wang LL, Gu H, Fan Y, Zhang Y, Wu D, Miao JN, et al. Up-regulated FHL1 expression maybe involved in the prognosis of Hirschsprung's disease. Int J Med Sci 2014;11:262-7.  Back to cited text no. 20
    
21.
Tiffin HR, Jenkins ZA, Gray MJ, Cameron-Christie SR, Eaton J, Aftimos S, et al. Dysregulation of FHL1 spliceforms due to an indel mutation produces an Emery-Dreifuss muscular dystrophy plus phenotype. Neurogenetics 2013;14:113-21.  Back to cited text no. 21
    
22.
Domenighetti AA, Chu PH, Wu T, Sheikh F, Gokhin DS, Guo LT, et al. Loss of FHL1 induces an age-dependent skeletal muscle myopathy associated with myofibrillar and intermyofibrillar disorganization in mice. Hum Mol Genet 2014;23:209-25.  Back to cited text no. 22
    
23.
Xu Y, Liu Z, Guo K. Expression of FHL1 in gastric cancer tissue and its correlation with the invasion and metastasis of gastric cancer. Mol Cell Biochem 2012;363:93-9.  Back to cited text no. 23
    
24.
Wu SM, Shih LH, Lee JY, Shen YJ, Lee HH. Estrogen enhances activity of Wnt signaling during osteogenesis by inducing Fhl1 expression. J Cell Biochem 2015;116:1419-30.  Back to cited text no. 24
    
25.
Ren W, Lian P, Cheng L, Du P, Guan X, Wang H, et al. FHL1 inhibits the growth of tongue squamous cell carcinoma cells via G1/S cell cycle arrest. Mol Med Rep 2015;12:3958-64.  Back to cited text no. 25
    
26.
Li X, Jia Z, Shen Y, Ichikawa H, Jarvik J, Nagele RG, et al. Coordinate suppression of Sdpr and Fhl1 expression in tumors of the breast, kidney, and prostate. Cancer Sci 2008;99:1326-33.  Back to cited text no. 26
    
27.
Shen Y, Jia Z, Nagele RG, Ichikawa H, Goldberg GS. SRC uses cas to suppress Fhl1 in order to promote nonanchored growth and migration of tumor cells. Cancer Res 2006;66:1543-52.  Back to cited text no. 27
    
28.
Ding L, Wang Z, Yan J, Yang X, Liu A, Qiu W, et al. Human four-and-a-half LIM family members suppress tumor cell growth through a TGF-beta-like signaling pathway. J Clin Invest 2009;119:349-61.  Back to cited text no. 28
    
29.
Scully R. The spindle-assembly checkpoint, aneuploidy, and gastrointestinal cancer. N Engl J Med 2010;363:2665-6.  Back to cited text no. 29
    
30.
Brito DA, Yang Z, Rieder CL. Microtubules do not promote mitotic slippage when the spindle assembly checkpoint cannot be satisfied. J Cell Biol 2008;182:623-9.  Back to cited text no. 30
    
31.
Hari M, Loganzo F, Annable T, Tan X, Musto S, Morilla DB, et al. Paclitaxel-resistant cells have a mutation in the paclitaxel-binding region of beta-tubulin (Asp26Glu) and less stable microtubules. Mol Cancer Ther 2006;5:270-8.  Back to cited text no. 31
    
32.
Pan Z, Gollahon L. Paclitaxel attenuates Bcl-2 resistance to apoptosis in breast cancer cells through an endoplasmic reticulum-mediated calcium release in a dosage dependent manner. Biochem Biophys Res Commun 2013;432:431-7.  Back to cited text no. 32
    
33.
Zaffaroni N, Pennati M, Colella G, Perego P, Supino R, Gatti L, et al. Expression of the anti-apoptotic gene survivin correlates with taxol resistance in human ovarian cancer. Cell Mol Life Sci 2002;59:1406-12.  Back to cited text no. 33
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>Introduction>Methods>Results>Discussion>Article Figures
  In this article
>References

 Article Access Statistics
    Viewed1324    
    Printed62    
    Emailed0    
    PDF Downloaded54    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]