Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2017  |  Volume : 13  |  Issue : 5  |  Page : 823-828

Functional analysis of RET with multiple endocrine neoplasia type 2


1 Oral Medicine Department, Beijing Stomatological Hospital, Capital Medical University, Beijing 100050; Department of Stomatology, Hospital of FIRMACO The Fourth Affiliated Hospital of Inner Mongolia Medical University, Baotou 014031, China
2 Oral Medicine Department, Beijing Stomatological Hospital, Capital Medical University, Beijing 100050, China
3 Beijing Institute of Dental Research, Capital Medical University, Beijing 100050, China

Date of Web Publication13-Dec-2017

Correspondence Address:
Ying Hu
No 4, Tiantan West, Dongcheng District, Beijing 100050
China
Zheng Sun
Oral Medicine Department, Beijing Stomatological Hospital, Capital Medical University, Beijing 100050
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jcrt.JCRT_274_17

Rights and Permissions
 > Abstract 


Background: Multiple endocrine neoplastic type 2 (MEN2) is an endocrine carcinoma syndrome which is caused by a germline activation mutation that occurs during transfection (RET) proto-oncogene transmission. MEN2A patients are affected by RET (C634Y, C634R) mutation; MEN2B patients are affected by RET (M918T) mutation.
Aims: We aim to identify RET mutations' (C634R and M918T) expression, location, and signaling activation during the disease's progression, which providing a theoretical basis for the study on etiology of multiple endocrine neoplasia.
Settings and Design: This study was conducted to determine whether RET dysfunction involves an induced mutation into SK-N-MC cells.
Materials and Methods: Wildtype RET and mutant RET plasmids (M918T and C634R) were constructed and transfected into SK-N-MC cells, the protein level was detected by Western blot, the efficiency of the transfected cells was detected by real time PCR, and the location of RET protein in cells as-determined by immunofluorescence. SK-N-MC cells with different RET plasmids treated/untreated by GDNF, AKT and ERK1/2 phosphorylation detected by specific antibodies.
Results: We found that C634R mutation could enhance RET protein expression and change the location of the mutated protein and forced it into the nucleus, GDNF treatment alone can only enhance M918T RET phosphorylation level and not impact WT or C614R mutation, and AKT/ERK1/2 pathway can be affected by GDNF treatment.
Conclusion: RET dysfunction involves an induced mutation into SK-N-MC cells.

Keywords: AKT/extracellular signal regulated kinase 1/2 Pathway, C634R mutation, M918T mutation, Multiple endocrine neoplasia type 2, RET


How to cite this article:
Zhang M, Liu Y, Fu J, Hu Y, Sun Z. Functional analysis of RET with multiple endocrine neoplasia type 2. J Can Res Ther 2017;13:823-8

How to cite this URL:
Zhang M, Liu Y, Fu J, Hu Y, Sun Z. Functional analysis of RET with multiple endocrine neoplasia type 2. J Can Res Ther [serial online] 2017 [cited 2019 Nov 18];13:823-8. Available from: http://www.cancerjournal.net/text.asp?2017/13/5/823/220466




 > Introduction Top


Multiple endocrine neoplasia (MEN) encompasses an array of endocrine disorders involving the pituitary gland, parathyroid gland, thyroid gland, and pancreas. The disorders are categorized as type 1 or type 2: type 1 includes autosomal dominant diseases causing parathyroid tumors, pancreatic islet cells tumors, and pituitary adenomas; some patients may also present adrenal cortical tumors and carcinoid tumors.[1],[2] MEN2 is also an autosomal dominant syndrome. The major components of the syndrome are medullary thyroid carcinoma (MTC), pheochromocytoma (PHEO), and hyperparathyroidism (HPT). MEN2 includes three subtypes: MEN2A, MEN2B, and familial MTC (FMTC). This paper focuses primarily on MEN2. MEN2A is the most common manifestation of MEN2.

The most obvious characteristic of MEN2A is MTC (90%–100%) normally occurring between the ages of 10 and 30 years. MTC is also the most common cause of death in MEN2 patients.[3] MTC typically occurs in early childhood for MEN2B patients, in adulthood for MEN2A patients, and in middle age for FMTC patients. Bilateral PHEO occurs in 50% of these cases and primary HPT in 25%.[4] MEN2B is the rarest of these disorders, comprising approximately 5% to 10% of the total. The manifestation of MEN2B is similar to MEN2A; the patients generally experience MTC (90%–100%) and PHEO (50%) but have no parathyroid component.[5] The most unique clinical manifestation characteristics of MEN2B are oral/ocular neuromas, skeletal marfanoids, limb muscle weakness, and structural problems in the long bones; mucosal neurogenic lesions usually affect the bowel lining.[6],[7],[8] Oral abnormalities are generally interpreted as plexiform neurofibromas but with noted similarities to neuromas and myelinated neurons.[6] Maxillofacial manifestations may also be present as dental central diastemas in either arch, apertognathia, or macroglossia in some patients.[9] The high lethality rate of MTC, which is the most important component of MEN2, makes correctly diagnosing the syndrome a crucial endeavor; recognizing the oral and maxillofacial abnormalities common in MEN2B helps to ensure accurate diagnoses.

This syndrome is caused by a germline activation mutation that occurs during transfection (RET) proto-oncogene transmission. MEN2A and MEN2B are both associated with the same region of chromosome 10q11.2.[10] More than 95% of cases are due to a single point mutation in the RET proto-oncogene. The RET gene contains 21 exons which encode a tyrosine kinase (TK) receptor. The ligands belong to the glial cell line-derived neurotrophic factor (GDNF) protein family. RET binds to the GDNF ligand, triggering RET homodimerization, and transforming the RET intracytoplasmic domain.[11] RET induces abnormal growth and differentiation of cells derived from the neural crest including C cells of the thyroid and cells of the adrenal medulla.[12],[13] Germline mutations of proto-oncogene RET are responsible for MEN2A in exons 10, 11, 13, 14, and 15; and the mutation of RET in exon 16 exceeds 95% in MEN2B cases.[12],[14] Clearly, there is a correlation between RET-activated mutation and corresponding phenotypes.

Most of the above mutations occur in extracellular cysteine residue. RET activates the phosphorylation of tyrosine residues in downstream proteins such as phosphoinositide 3-kinase (PI3K) and mitogen-activated protein kinase (MAPK), but almost all MEN2B cases are caused by changes in the intracellular domain due to RET. This study was conducted to determine whether RET dysfunction involves an induced mutation into SK-N-MC cells.

The goal of this study was to identify RET mutations' (C634R and M918T) expression, location, and signaling activation during the disease's progression, which providing a theoretical basis for the study on etiology of MEN and guiding the patients of early diagnosis and treatment to improve the living quality.


 > Materials and Methods Top


Cell culture

SK-N-MC cells (human primitive neuroectodermal tumor cells) were maintained in Modified Eagle Medium (Hyclone, Logan, UT, USA) supplemented with 15% fetal bovine serum (Gibco, Waltham, MA, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin (Hyclone, Logan, UT, USA) in 5% CO2 at 37°C.

Antibodies and reagents

Antibodies against RET, phosphotyrosine, AKT, AKT (phospho S473), extracellular signal-regulated kinase 1/2 (ERK1/2), and ERK1 + ERK2 (phospho Y180) were purchased from Abcam (Shanghai, China). Anti-glyceraldehyde 3-phosphate dehydrogenase antibody was purchased from Goodhere Biotechnology Co., Ltd. (Hangzhou, China). Goat Anti-rabbit IgG (H + L) secondary antibody and horseradish peroxidase conjugate were purchased from Invitrogen (Carlsbad, CA, USA). Rhodamine (TRITC) AffiniPure Goat Anti-rabbit IgG (H + L) (111-025-003) was purchased from Jackson (West Grove, PA, USA).

Plasmid construction and transfection

The RET-pcDNA3.1(+) plasmid was provided by Professor Toshide Iwashita of the Department of Pathology, Nagoya University Graduate School of Medicine. To construct the necessary mutants, two missense mutations identified in MEN2, M918T, and C634R, were introduced into RET cDNA by point mutation and polymerase chain reaction (PCR), respectively. Wild-type (WT) RET and mutant RET plasmids were transfected into SK-N-MC cells with Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) transfection reagent. Forty-eight hours after transfection, the cells were treated and gathered for further analysis.

Immunofluorescence

Cells were seeded on cover glass in six well dishes before transfection. The slices were treated and fixed 48 h after transfection, then incubated with antibodies against RET and secondary antibodies that linked to fluorophores. Nuclei were stained with 4',6-diamidino-2-phenylindole, then the reaction was examined through inverted fluorescence microscopy.

Western blotting

Cells were lysed with RIPA lysis buffer (CwBiotech, Beijing, China), and their cytoplasmic and nuclear proteins were separated with an NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Fisher, Waltham, USA) according to the manufacturer's instructions. The protein concentrations were quantified with a BCA Kit (CwBiotech, Beijing, China). Equal amount (for total protein lysate) or equal volume of proteins (for cytoplasmic/nuclear protein) were loaded and separated with a sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel electrophoresis system; the separated bands were transferred onto polyvinylidene difluoride membrane (Millipore, Bedford, MA, USA), blocked with 5% nonfat milk at room temperature for 1 h and incubated with individual primary antibody overnight at 4°C. The specimens were washed, then supplied secondary antibodies, and incubated for another 1 h. Protein bands were determined using a chemiluminescence system (Beyotime, Haimen, China).

Efficiency of transfection

Cells were seeded on cover glass in six well dishes before transfection and then collected 24 h after transfection. DNA was extracted with a DNA extraction kit, and QPCR was actualized. Single-copy gene albumin was used as an internal reference. Based on the sequences reported in the GenBank database, albumin and RET primers were designed, selected, and ordered using Primer-Premier 5 (Premier Biosoft Interpairs, Palo Alto, CA, USA). The primers for amplification of albumin are alb-F: CGGCGGCGGGCGGCGCGGCTGGGCGGAAATGCTGCACAGAATCCTTG and alb-R: GCCCGGCCCGCCGCGCCCGTCCCGCCGGA AAAGCATGGTCGCCTGTT. The primers for amplification of albumin are RET plasmid are RET-F: GGCTTGTCCCGAGATGTTTAT and RET-R: TCAGGAGGAATCCCAGGATAG.


 > Results Top


C634R mutation enhances RET protein expression

WT RET and two mutant RET plasmids were transfected into SK-N-MC cells. The protein level of different RET protein mutations in cells was separated 48 h after transfection by SDS-PAGE and detected through Western blotting. C634R mutation showed a greater extent of expression than WT or M918T mutation [Figure 1]a. To validate this observation (i.e., to ensure it was not simply characterized by transfection efficiency in the experiments,) single-copy gene albumin was used as a loading control in the real-time PCR analysis. The ratio of RET/albumin served as the transfection reference [Figure 1]b.
Figure 1: C634R mutation affects RET protein expression. (a) Significant C634R mutation expression. The protein level of different mutated RET proteins in SK-N-MC cells as detected by Western blot after 48 h transfection. (b) Transfection efficiency of different mutated RET plasmids. The efficiency of the transfected cells as detected by real-time polymerase chain reaction with single-gene Tel as a loading control; RET/alb ratio serves as the transfection reference

Click here to view


C634R mutation affects protein location in the cell

In addition to changes in expression, the location of the RET proteins was also observed by immunofluorescence. As shown in [Figure 2]a, C634 mutation changed the location of the mutated protein and forced it into the nucleus. Similar to WT RET, M918 mutation did not appear to affect the protein's location in the cell; both were observed in the cytoplasm. This phenomenon was further validated by separating the cytoplasmic and nuclear protein with an NE-PER Nuclear and Cytoplasmic Extraction Kit and blotting for the specific antibodies [Figure 2]b and [Figure 2]c.
Figure 2: C634R mutation affects RET protein location C634R RET located in nucleus. Different mutations and wild-type RET plasmids transfected into in SK-N-MC cells; the location of RET protein in cells as determined by immunofluorescence (a) or by fixing the cytoplasmic protein (b) and nuclear protein (c) separated through NE-PER nuclear and cytoplasmic extraction kit

Click here to view


M918T RET is readily phosphorylated by glial cell line-derived neurotropic factor treatment

GDNF and related molecules work to create a unique multicomponent receptor system consisting of RET TK. These promote the survival of various neurons and may represent effective therapeutic agents for neurodegenerative disease treatment. GDNF/RET signaling was also found to play a crucial role in normal tissue development and differentiation. The mutations resulted in RET activation or inactivation by various mechanisms, and the biological properties of mutant proteins appeared to be correlated with disease phenotypes.

Current researchers are extensively investigating signaling pathways activated by GDNF or mutant RET in an effort to understand the molecular mechanisms of disease development and the physiological roles of the GDNF family ligands. Here, we found that GDNF treatment alone can only enhance M918T RET phosphorylation level; it does not impact WT or C614R mutation [Figure 3].
Figure 3: M918T RET is readily phosphorylated by glial cell line-derived neurotropic factor treatment. Different mutations and Wild-type RET plasmids transfected into in SK-N-MC cells treated/untreated by glial cell line-derived neurotropic factor; phosphorylated RET level determined by blotting in pY antibody

Click here to view


AKT/extracellular signal-regulated kinase 1/2 pathway is affected by glial cell line-derived neurotropic factor treatment

AKT and ERK1/2 are the key molecules of RAS and PI3K signal pathways. We examined the signal transduction of AKT and ERK1/2 in different RET mutations activated by GDNF. The concentration of GDNF was separated into 0, 30, 60, and 90 (ng/ml) groups across which AKT and ERK1/2 phosphorylation levels in normal or mutant RET samples were compared. The phosphorylation of AKT increased as GDNF concentration increased in RET-WT [Figure 4]a and [Figure 4]b, but this tendency was not observed in C634R and M918T groups. This phoneme was also confirmed by the phosphorylation of ERK1/2 [Figure 4]a and [Figure 4]c. These results altogether suggest that only WT RET responded to GDNF treatment.
Figure 4: AKT/extracellular signal-regulated kinase 1/2 pathway is activated by glial cell line-derived neurotropic factor treatment via Wild-type RET pathway but not mutation. Different RET plasmids transfected into in SK-N-MC cells and treated/untreated by glial cell line-derived neurotropic factor; AKT and extracellular signal-regulated kinase 1/2 phosphorylation detected per specific antibodies (a). Gray values analyzed in Image J software (b and c). Data in bar graphs represent the mean+-standard deviation of three repeated experiments (*P < 0.05, **P < 0.05)

Click here to view



 > Discussion Top


Many previous researchers have demonstrated that MEN2A, MEN2B, and FMTC are caused by mutation of the RET gain-of-function. MEN2A is mainly caused by exon 8–14 mutation, whereas MEN2B occurs mainly due to 15 and 16 exon mutation. Exon 8–11 mutations can cause the receptor to spontaneously change into dimer form; exon 13 and 14 mutation can lead to abnormalities in the TK catalytic site in combination with a substrate. Exon 15 and 16 mutations cause the RET protein to change from a membrane receptor into a cell receptor, thus activating the abnormal signal transduction pathways in cells. Extracellular domain C634R mutation impairs the RET maturation or its translocation signaling pathway. Intracellular domain mutations can disturb the catalytic activity of RET and intracellular signal transduction.

Activating RET mutations, such as C634R and M918T, cause oncogenic lesions affecting mainly the endocrine organs. While various studies have uncovered details regarding normal RET activation and numerous signaling pathways that it activates, we still lack detailed knowledge, of which pathway is critical for C634R and M918T mediated oncogenesis. Kulkarni and Franklin[15] showed that C634R mutation expression leads to ERK phosphorylation/activation, required for induction of N-Myc mRNA and protein expression. Grubbs et al.[16] demonstrated that somatic CDKN2C loss is associated with the presence of distant metastasis at presentation as well as decreased overall survival, a relationship enhanced by concomitant RETM918T mutation. To analyze the RET function, we transfected two mutated (C634R and M918T) cDNA into SK-N-MC cells to establish a cell line. The transformation efficiency of RET-MEN2 was relatively low, likely due to the G418 drug itself. The experimental screening time was only 2 days, which was not ideal. Most of the cells were WT cells, so immunofluorescence images contained only a few cells with target protein fluorescence signals in each field of vision.

The C634R mutation was located in the cysteine domain and M918T mutation was located in TK domain 2. These amino acids were not conserved in most of the other TKs. The phosphorylation levels of RET-WT, RET-C634R, and RET-M918T were not significantly different after GDNF treatment compared to the control. This mutation may have impaired adenosine triphosphate binding, resulting in the failure of RET kinase to undergo tyrosine phosphorylation. The fact that these mutations almost completely impaired the RET kinase activity suggests that these amino acids are essential components of the three-dimensional structure of the RET kinase domain. Further, missense mutations in the enzymes generally decreased in regard to catalytic activities and/or expression levels over the course of the experiment.

The PI3K signal pathway plays an important role in regulating the proliferation, growth, apoptosis, migration, and metabolism of cells. In our experiment, PI3K activated and converted the plasma membrane after stimulation with growth factor, which drew signal proteins in the pleckstrin homology (PH) domain to the inner face of the plasma membrane. Among these PH domain proteins, the most important originate from AKT kinases. The AKT family contains three highly conserved members: AKT1, AKT2, and AKT3. When PI3K is activated, all three isoforms of AKT are translocated form the cytoplasm to the plasma membrane and are phosphorylated by phosphoinositide-dependent kinase 1 (PDK1) and potential PDK2, respectively, at two conserved residues; active AKT members further phosphorylate and activate several downstream effectors.[17] The deregulation of AKT signaling has been observed in many human cancers (e.g., breast, pancreatic, and thyroid cancers). Overexpression of constitutively active AKT1 in the β-cells of transgenic mice induces cell proliferation, growth, and survival.[18],[19] RET-mediated cell transformation in MEN2 is also critically dependent on the activation of the PI3K/AKT pathway.[20] To date, despite many studies on the molecular mechanisms of the PI3K/AKT pathway as involved in the regulation of endocrine cell proliferation, their effects on apoptosis and growth remain unclear. The hyperactivation of AKT has also been observed in various cancers; it plays a critical role in regulating cancer cell survival.

The Ras-Raf-MEK-MAPK-ERK signaling pathway is also known to play a significant role in cell differentiation, proliferation, and survival. This pathway transduces extracellular signals from the ligands of receptor TKs in the cell membrane to nuclear transcription factors that regulate gene product synthesis. Mutations in proteins of this pathway are observed in many cancers, resulting in overactive signaling and unchecked cell growth. Accordingly, its proteins and receptors make excellent targets for anticancer chemotherapeutic compounds.

ERKs are classical MAPKs that receive signals from MEK and other proteins involved in the MAPK cascade, resulting in the downstream activation of transcription factors. These transcription factors regulate the production of gene products responsible for meiosis, mitosis, and cell differentiation. Signaling involving ERK1 or ERK2 plays a major role not only in the development and progression of cancers but also in mood disorders.


 > Conclusion Top


In conclusion, two mutations, C634R and M918T, were observed in this study corresponding to MEN2A and MEN2B. Their expression, location, and signaling activation characterize the mechanism of mutation during the disease's progression, including C634R mutation could enhance RET protein expression and change the location of the mutated protein and forced it into the nucleus, GDNF treatment can only enhance M918T RET phosphorylation level and not impact WT or C614R mutation and affect AKT/ERK1/2 pathway, which providing a theoretical basis for the study on etiology of multiple endocrine neoplasia, and guiding the patients of early diagnosis and treatment to improve the living quality.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
 > References Top

1.
Marini F, Carbonell Sala S, Falchetti A, Caramelli D, Brandi ML. The genetic ascertainment of multiple endocrine neoplasia type 1 syndrome by ancient DNA analysis. J Endocrinol Invest 2008;31:905-9.  Back to cited text no. 1
[PUBMED]    
2.
Li Y, Zhou X. Comparison between endoscopic thyroidectomy and conventional open thyroidectomy for papillary thyroid microcarcinoma: A meta-analysis. J Cancer Res Ther 2016;12:550-5.  Back to cited text no. 2
[PUBMED]    
3.
Abdelhakim A, Barlier A, Kebbou M, Benabdeljalil N, Timinouni M, Taoufiq F, et al. RET genetic screening in patients with medullary thyroid cancer: The Moroccan experience. J Cancer Res Ther 2009;5:198-202.  Back to cited text no. 3
[PUBMED]    
4.
American Thyroid Association Guidelines Task Force. Kloos RT, Eng C, Evans DB, Francis GL, Gagel RF, et al. Medullary thyroid cancer: Management guidelines of the American Thyroid Association. Thyroid 2009;19:565-612.  Back to cited text no. 4
    
5.
MacIntosh RB, Shivapuja PK, Krzemien MB, Lee M. Multiple endocrine neoplasia type 2B: Maxillofacial significance in 5 cases. J Oral Maxillofac Surg 2014;72:2498.e1-17.  Back to cited text no. 5
    
6.
Carney JA, Sizemore GW, Lovestedt SA. Mucosal ganglioneuromatosis, medullary thyroid carcinoma, and pheochromocytoma: Multiple endocrine neoplasia, type 2b. Oral Surg Oral Med Oral Pathol 1976;41:739-52.  Back to cited text no. 6
[PUBMED]    
7.
Carney JA, Bianco AJ Jr., Sizemore GW, Hayles AB. Multiple endocrine neoplasia with skeletal manifestations. J Bone Joint Surg Am 1981;63:405-10.  Back to cited text no. 7
    
8.
Grobmyer SR, Guillem JG, O'Riordain DS, Woodruff JM, Shriver C, Brennan MF, et al. Colonic manifestations of multiple endocrine neoplasia type 2B: Report of four cases. Dis Colon Rectum 1999;42:1216-9.  Back to cited text no. 8
    
9.
Schenberg ME, Zajac JD, Lim-Tio S, Collier NA, Brooks AM, Reade PC, et al. Multiple endocrine neoplasia syndrome – Type 2b. Case report and review. Int J Oral Maxillofac Surg 1992;21:110-4.  Back to cited text no. 9
    
10.
Khairi MR, Dexter RN, Burzynski NJ, Johnston CC Jr. Mucosal neuroma, pheochromocytoma and medullary thyroid carcinoma: Multiple endocrine neoplasia type 3. Medicine (Baltimore) 1975;54:89-112.  Back to cited text no. 10
[PUBMED]    
11.
Airaksinen MS, Saarma M. The GDNF family: Signalling, biological functions and therapeutic value. Nat Rev Neurosci 2002;3:383-94.  Back to cited text no. 11
[PUBMED]    
12.
Eng C, Clayton D, Schuffenecker I, Lenoir G, Cote G, Gagel RF, et al. The relationship between specific RET proto-oncogene mutations and disease phenotype in multiple endocrine neoplasia type 2. International RET mutation consortium analysis. JAMA 1996;276:1575-9.  Back to cited text no. 12
[PUBMED]    
13.
Moline J, Eng C. Multiple endocrine neoplasia type 2: An overview. Genet Med 2011;13:755-64.  Back to cited text no. 13
[PUBMED]    
14.
Ponder BA. The phenotypes associated with ret mutations in the multiple endocrine neoplasia type 2 syndrome. Cancer Res 1999;59:1736s-41s.  Back to cited text no. 14
[PUBMED]    
15.
Kulkarni MV, Franklin DS. N-myc is a downstream target of RET signaling and is required for transcriptional regulation of p18(Ink4c) by the transforming mutant RET (C634R). Mol Oncol 2011;5:24-35.  Back to cited text no. 15
[PUBMED]    
16.
Grubbs EG, Williams MD, Scheet P, Vattathil S, Perrier ND, Lee JE, et al. Role of CDKN2C copy number in sporadic medullary thyroid carcinoma. Thyroid 2016;26:1553-562.  Back to cited text no. 16
[PUBMED]    
17.
Vivanco I, Sawyers CL. The phosphatidylinositol 3-kinase AKT pathway in human cancer. Nat Rev Cancer 2002;2:489-501.  Back to cited text no. 17
[PUBMED]    
18.
Cui Y, Xu J, Xin L, Tian Y, Zhan Z, Qi D, et al. Gene mutation characteristics of nonsmall-cell lung carcinoma patients with wild-type epidermal growth factor receptor and sensitivity to Tarceva therapy. J Cancer Res Ther 2015;11 Suppl 1:C80-3.  Back to cited text no. 18
    
19.
Tuttle RL, Gill NS, Pugh W, Lee JP, Koeberlein B, Furth EE, et al. Regulation of pancreatic beta-cell growth and survival by the serine/threonine protein kinase Akt1/PKBalpha. Nat Med 2001;7:1133-7.  Back to cited text no. 19
[PUBMED]    
20.
Segouffin-Cariou C, Billaud M. Transforming ability of MEN2A-RET requires activation of the phosphatidylinositol 3-kinase/AKT signaling pathway. J Biol Chem 2000;275:3568-76.  Back to cited text no. 20
[PUBMED]    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Conclusion>Article Figures
  In this article
>References

 Article Access Statistics
    Viewed1356    
    Printed27    
    Emailed0    
    PDF Downloaded68    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]