Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2016  |  Volume : 12  |  Issue : 7  |  Page : 186-190

Screening of gene mutations associated with bone metastasis in nonsmall cell lung cancer


Department of Lung Cancer, The Affiliated Hospital of Military Medical Sciences, The 307th Hospital of Chinese People's Liberation Army, Beijing, China

Date of Web Publication21-Feb-2017

Correspondence Address:
Wang Hong
Department of Lung Cancer, The Affiliated Hospital of Military Medical Sciences, The 307th Hospital of Chinese People' s Liberation Army, 100071 Beijing
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0973-1482.200597

Rights and Permissions
 > Abstract 

Objective: The objective of this study is to assess the gene mutation of advanced nonsmall cell lung cancer (NSCLC) patients with bone metastasis using next-generation sequencing (NGS), and screen for the driver genes which are associated with bone metastasis of lung cancer.
Materials and Methods: Eight clinicopathologic samples from advanced NSCLC combined with bone metastasis patients were collected. Exome sequencing was conducted within 483 tumor-associated genes using Hiseq 2000_PE75 NGS platform.
Results: Three thousand six hundred and twenty gene mutations were identified, including point mutation, insertion, and deletion. Among all genes associated with lung cancer signaling pathways, fibroblast growth factor receptor (FGFR), and cyclin-dependent kinase 12 (CDK12) were found to be mutated in all eight patients. The top three genes were FGFR, ataxia telangiectasia mutated, and CDK12, according to mutation frequency. In the meanwhile, hepatocyte nuclear factor 1 alpha, adenomatous polyposis coli, and CD22 were found to be mutated in all eight patients with an over 50% mutation frequency (75%, 62.5%, and 50%, respectively), which would be the most potential genes accounting for bone metastasis in lung cancer patients.
Conclusion: Our findings shed light on several important signalling pathways involved in NSCLC, and suggest new potential molecular targets for treatment of NSCLC patients with bone metastasis.

Keywords: Bone metastasis, gene mutation, next-generation sequencing, nonsmall cell lung cancer


How to cite this article:
Zhang K, Zhang M, Zhu J, Hong W. Screening of gene mutations associated with bone metastasis in nonsmall cell lung cancer. J Can Res Ther 2016;12:186-90

How to cite this URL:
Zhang K, Zhang M, Zhu J, Hong W. Screening of gene mutations associated with bone metastasis in nonsmall cell lung cancer. J Can Res Ther [serial online] 2016 [cited 2018 Dec 15];12:186-90. Available from: http://www.cancerjournal.net/text.asp?2016/12/7/186/200597


 > Introduction Top


Lung cancer is one of the most common malignancy in China. Among all cancers, the morbidity and mortality of lung cancer rank first. Nonsmall cell lung cancer (NSCLC) accounts for 75%–80% lung cancer. Moreover, bone metastasis is one of the common blood metastases of lung cancer.[1],[2],[3] The median survival time of lung cancer patients after bone metastasis is 6–10 months, while the 1-year survival rate is only 40%–50% after the clinical treatment.[4] 46% of lung cancer patients with bone metastasis are complicated by bone-related events, which is the major risk factor of life quality and survival of the patients.[5] The study of associated driven genes in bone metastasis of lung cancer will provide new insight into the mechanism, potential therapeutic targets, promote the prognosis and survival in clinic. Our findings shed light on several important signalling pathways involved in NSCLC, and suggest new potential molecular targets for treatment of NSCLC patients with bone metastasis.


 > Materials and Methods Top


Materials

Eight cases of pathologic bone metastasis NSCLC patients from January 2013 to December 2014 in our hospital were randomly enrolled. Clinical characteristics are shown in [Table 1]. Cancerous tissues were all formalin fixed and paraffin-embedded samples. This study approved by Our Hospital Medical Ethics Committee and the patients were informed consent.
Table 1: The clinical characteristics of eight cases patients

Click here to view


Methods

To analyze the gene mutations of bone metastasis NSCLC patients, exome sequencing was conducted with 483 tumor-associated genes by Hiseq 2000_PE75 next-generation sequencing platform. The tumor-associated genes include oncogene, tumor suppressor gene, and protein kinase family. The major mutations include point mutation, insertion, and deletion. In the meanwhile, Sanger sequencing was performed with hepatocyte nuclear factor 1 alpha (HNF1A), of which mutation consistency was 75%. The primers were as follows: Forward: AGAATCCAGGAGCTGGAAGAG; Reverse: AGATTTTGGTCTGTTTGGTTCAC.


 > Results Top


Tumor-associated signaling genes

A total of 3620 mutations were identified within 483 detected genes, including point mutation, insertion, and deletion. We analyzed lung cancer-associated growth factor receptor genes EGFR/HER2/HER3/HER4/FGFR/PDGFR/IGF1R/NTRK, mitogen-activated protein kinase (MAPK) signaling pathway genes RAF/RAS/ERK/NF1/PTEN, phosphatidylinositol 3-kinase (PI3K)-Akt signaling pathway genes PI3KCA/AKT/mTOR/TSC1/TSC2, WNT signaling pathway genes GSK3 β/APC/CTNNB1, p53 signaling pathway, and cell-cycle regulation-associated genes ATM/ATR/p53/MDM2/CDK/RB. Within eight growth factor receptor genes, we identified 126 gene mutations, where mutations of fibroblast growth factor receptor were found in all eight patients with a total of 33 mutations. In addition, there were three consistent mutations, of which activation mutations promote lung cancer cell proliferation, and inhibition reversed that with inhibitors.[6],[7],[8] Within 5 MAPK signaling pathway genes, we identified 37 gene mutations, where mutations of neurofibromatosis type 1 (NF1) were found in 7 patients with a total of 17 mutations. The inactivation of NF1 participates in the over-activation of RAS-MAPK and PI3K-Akt signaling.[9] Within 5 PI3K-Akt signaling pathway genes, we identified 76 gene mutations, where mutations of adenomatous polyposis coli (APC) were found in 7 patients with a total of 25 mutations and one consistent mutation existing in 5 patients. Within 12 p53 signaling pathway and cell cycle regulation-associated genes, we identified 87 gene mutations, where mutations of ataxia-telangiectasia mutated were found in 6 patients with a total of 29 mutations and mutations of cyclin-dependent kinase 12 were found in all patients with a total of 29 mutations and 3 consistent mutations [Figure 1] and [Figure 2].
Figure 1: Pie chart summarized gene mutations in 5 tumor-associated signaling pathways

Click here to view
Figure 2: Heatmap of mutation status of 33 tumor-associated genes. White brick represents that the mutation rate is zero

Click here to view


Consistent mutation genes

Consistent mutations were found in 16 genes, including insertion, deletion, and point mutation. There were 13 and 3 genes with the mutation consistency higher than 37.5% and 50%, respectively. The mutation consistency of HNF1A was 75%, and mutation site was 1394_1395ins8; the mutation consistency of APC was 62.5%, and mutation site was A818G; the mutation consistency of CD22 was 50%, and mutation site was G1703A [Table 2] and [Figure 3], [Figure 4]. These genes might be involved in both development and progression and bone metastasis of lung cancer.
Table 2: Gene mutation characteristics of 16 tumor - associated genes

Click here to view
Figure 3: Consistent mutation rate of 16 tumor-associated genes

Click here to view
Figure 4: Heatmap of mutation consistency of hepatocyte nuclear factor 1 alpha, adenomatous polyposis coli, and CD22 in eight patients

Click here to view


Hepatocyte nuclear factor 1-alpha

HNF1A/transcription factor 1 (TCF 1) is a transcription factor, and its multiple function domains bind, respectively, to CTNNB1, DNA, and lymphoid enhancer factor and other transcription factors.[10] It has been reported that HNF1A/TCF1 correlated to lung adenocarcinoma,[11] liver adenocarcinoma,[12],[13],[14],[15] pancreatic carcinoma,[16],[17] endometrial cancer,[18] and esophageal adenocarcinoma.[19] In addition, the inactivation of HNF1A results in the overexpression of human epidermal growth factor receptor 2, mammalian target of rapamycin, PGGFA/B, and CCND1.[20] HNF1A participates in the expression of MMP14 and possibly correlated with bone metastasis.[21] A study investigated the related mutation of 158 known cancer susceptibility genes in health people, which has been published in PLOS ONE. TCAT is a short tandem repeat sequence of HNF1A, which has four repeats in normal people, and the repeats are suspected to be related to cancer susceptibility. There are three repeat insertions in 78% of East Asians, while the occurrence rate of four repeat insertions is only 0.88%, and two repeat insertion is none.[22] In this study, there were two repeat insertions in six of eight patients, which resulted in frameshift mutation. Sanger sequencing revealed that, except for one patient limited by tissue volume, all patients were found to have insertion mutations, which were possibly related to bone metastasis of lung cancer. Next, high-throughput detection of clinical specimens can confirm the occurrence rate of the mutation, and further function analysis might reveal the influence on protein transcription by mutation protein and bone metastasis of lung cancer.

Adenomatous polyposis coli susceptibility gene

APC is a tumor suppressor gene, locates in chromosome 5q21, including 15 exons, coded a 300 kDa protein.[23] APC protein is a multiple function protein including participating in the regulation of WNT signaling pathway, inducing cell-cell adhesion, stabilizing cell cytoskeleton, and regulating cell-cycle and apoptosis.[24],[25] The most important function of APC protein is regulating cytoplasmic level of β-catenin as a negative regulator.[26] There is a mutation cluster region between codon 1286 to codon 1513 of APC gene, part of which is close to the binding site of β-catenin. As a result of mutation of this site, although the truncated APC can bind to β-catenin, it lost the ability of inducing degradation of β-catenin.[27] Germline mutation of APC is associated with genetical familial adenomatous polyposis, and somatic mutation of APC is correlated with sporadic colorectal carcinoma.[28] In the meantime, the mutation of APC was found in stomach cancer,[29] prostatic cancer,[30] lung cancer,[31],[32] and pancreatic cancer.[33] In this study, A818G mutation was found in five of eight patients, which was possibly related to bone metastasis of lung cancer, while further investigation needs to be conducted to reveal the mechanism.

CD22

CD22 is a 140 kDa transmembrane sialyl adhesion protein and a member of immunoglobulin superfamily. Its encoding gene includes 15 exons, and exon 4–10 encodes 7 extracellular Ig-like domains, of which domain 1 and 2 can bind to CD22 ligand. CD22 is found expressing in almost all mature B-cells and non-Hodgkin lymphoma, participating in B-cell receptor signaling and B cell homing.[34],[35],[36],[37],[38] CD22 is also found expressing in lung cancer tissues and is related to proliferation and survival of lung cancer cells, possibly, it takes a role in the metastasis of lung cancer. HB22.7 (a monoclonal antibody of CD22) was reported to inhibit the proliferation of lung cancer cells.[39] In this study, mutation G1703A in exon 10 was found in 4 of 8 patients. While it needs further investigation to explain whether this mutation is related to bone metastasis of lung cancer.


 > Discussion Top


At present, the general clinical therapy to inhibit osteoclast includes diphosphonate (zoledronic acid) and denosumab (an inhibitor of RANKL), while there is limited influence on patients survival.[40],[41] The overexpression of chemokine receptor CXCR in lung cancer specimens is associated with bone metastasis,[42] and Integrin family,[43] CD44,[44] and OPG/RANK/RANKL [45] signaling are closely related to bond metastasis of lung cancer. While the exactly mechanism of bone metastasis of lung cancer remains elusive, needing discovery of drive genes, or specific molecules, which could be therapeutic targets. In this study, we identified several consistent mutations associated with bone metastasis of lung cancer, in which the mutation consistency of HNF1A reached up to 75%. Next, high-throughput detection of clinical specimens can confirm the occurrence rate of the mutation, and further function analysis might reveal the influence on protein transcription by mutation protein and bone metastasis of lung cancer. In the meanwhile, the progress of radiotherapy and immunotherapy alleviate the sufferings of the patient to a great extent and Phase II and III clinical researches on treating bone metastasis are being carried out. In the future, more achievements on bone metastasis of lung cancer are expected, and personalized precision medicine is expected to promote life quality and survival of patients, according to individual difference of different patients.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
 > References Top

1.
Travis WD, Brambilla E, Muller-Hermelink HK, editors. Pathology and Genetics of Tumors of the Lung, Pleura, Thymus and Heart World Health Organization Classification of Tumors. Lyon: IARC Press; 2004. p. 9-67.  Back to cited text no. 1
    
2.
Hao J, Chen WQ. Beijing: 2012 Chinese Cancer Registry Annual Report. Peking: Military Medical Science Press; 2012.  Back to cited text no. 2
    
3.
Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, et al. Cancer statistics in China, 2015. CA Cancer J Clin 2016;66:115-32.  Back to cited text no. 3
    
4.
Tsuya A, Kurata T, Tamura K, Fukuoka M. Skeletal metastases in non-small cell lung cancer: A retrospective study. Lung Cancer 2007;57:229-32.  Back to cited text no. 4
    
5.
Rosen LS, Gordon D, Tchekmedyian NS, Yanagihara R, Hirsh V, Krzakowski M, et al. Long-term efficacy and safety of zoledronic acid in the treatment of skeletal metastases in patients with nonsmall cell lung carcinoma and other solid tumors: A randomized, phase III, double-blind, placebo-controlled trial. Cancer 2004;100:2613-21.  Back to cited text no. 5
    
6.
Liao RG, Jung J, Tchaicha J, Wilkerson MD, Sivachenko A, Beauchamp EM, et al. Inhibitor-sensitive FGFR2 and FGFR3 mutations in lung squamous cell carcinoma. Cancer Res 2013;73:5195-205.  Back to cited text no. 6
    
7.
Tchaicha JH, Akbay EA, Altabef A, Mikse OR, Kikuchi E, Rhee K, et al. Kinase domain activation of FGFR2 yields high-grade lung adenocarcinoma sensitive to a pan-FGFR inhibitor in a mouse model of NSCLC. Cancer Res 2014;74:4676-84.  Back to cited text no. 7
    
8.
Tanizaki J, Ercan D, Capelletti M, Dodge M, Xu C, Bahcall M, et al. Identification of oncogenic and drug-sensitizing mutations in the extracellular domain of FGFR2. Cancer Res 2015;75:3139-46.  Back to cited text no. 8
    
9.
Sandsmark DK, Zhang H, Hegedus B, Pelletier CL, Weber JD, Gutmann DH. Nucleophosmin mediates mammalian target of rapamycin-dependent actin cytoskeleton dynamics and proliferation in neurofibromin-deficient astrocytes. Cancer Res 2007;67:4790-9.  Back to cited text no. 9
    
10.
Atcha FA, Munguia JE, Li TW, Hovanes K, Waterman ML. A new beta-catenin-dependent activation domain in T cell factor. J Biol Chem 2003;278:16169-75.  Back to cited text no. 10
    
11.
Wu Y, Liu H, Shi X, Yao Y, Yang W, Song Y. The long non-coding RNA HNF1A-AS1 regulates proliferation and metastasis in lung adenocarcinoma. Oncotarget 2015;6:9160-72.  Back to cited text no. 11
    
12.
Sakellariou S, Morgan Y, Heaton N, Portmann B, Quaglia A, Tobal K. New monoallelic (partial tandem duplication) mutation of HNF1a gene in steatotic hepatocellular adenoma. Eur J Gastroenterol Hepatol 2011;23:623-7.  Back to cited text no. 12
    
13.
Holter S, Pollett A, Zogopoulos G, Kim H, Schwenter F, Asai K, et al. Hepatic adenomas caused by somatic HNF1A mutations in children with biallelic mismatch repair gene mutations. Gastroenterology 2011;140:735-6.  Back to cited text no. 13
    
14.
Jeannot E, Mellottee L, Bioulac-Sage P, Balabaud C, Scoazec JY, et al. Spectrum of HNF1A somatic mutations in hepatocellular adenoma differs from that in patients with MODY3 and suggests genotoxic damage. Diabetes 2010;59:1836-44.  Back to cited text no. 14
    
15.
Willson JS, Godwin TD, Wiggins GA, Guilford PJ, McCall JL. Primary hepatocellular neoplasms in a MODY3 family with a novel HNF1A germline mutation. J Hepatol 2013;59:904-7.  Back to cited text no. 15
    
16.
Luo Z, Li Y, Wang H, Fleming J, Li M, Kang Y, et al. Hepatocyte nuclear factor 1A (HNF1A) as a possible tumor suppressor in pancreatic cancer. PLoS One 2015;10:e0121082.  Back to cited text no. 16
    
17.
Pierce BL, Ahsan H. Genome-wide “pleiotropy scan” identifies HNF1A region as a novel pancreatic cancer susceptibility locus. Cancer Res 2011;71:4352-8.  Back to cited text no. 17
    
18.
Rebouissou S, Rosty C, Lecuru F, Boisselier S, Bui H, Le Frere-Belfa MA, et al. Mutation of TCF1 encoding hepatocyte nuclear factor 1alpha in gynecological cancer. Oncogene 2004;23:7588-92.  Back to cited text no. 18
    
19.
Yang X, Song JH, Cheng Y, Wu W, Bhagat T, Yu Y, et al. Long non-coding RNA HNF1A-AS1 regulates proliferation and migration in oesophageal adenocarcinoma cells. Gut 2014;63:881-90.  Back to cited text no. 19
    
20.
Pelletier L, Rebouissou S, Paris A, Rathahao-Paris E, Perdu E, Bioulac-Sage P, et al. Loss of hepatocyte nuclear factor 1alpha function in human hepatocellular adenomas leads to aberrant activation of signaling pathways involved in tumorigenesis. Hepatology 2010;51:557-66.  Back to cited text no. 20
    
21.
Shafizadeh N, Genrich G, Ferrell L, Kakar S. Hepatocellular adenomas in a large community population, 2000 to 2010: Reclassification per current World Health Organization classification and results of long-term follow-up. Hum Pathol 2014;45:976-83.  Back to cited text no. 21
    
22.
Bodian DL, McCutcheon JN, Kothiyal P, Huddleston KC, Iyer RK, Vockley JG, et al. Germline variation in cancer-susceptibility genes in a healthy, ancestrally diverse cohort: Implications for individual genome sequencing. PLoS One 2014;9:e94554.  Back to cited text no. 22
    
23.
Nakamura Y. The role of the adenomatous polyposis coli (APC) gene in human cancers. Adv Cancer Res 1993;62:65-87.  Back to cited text no. 23
    
24.
Chung DC. The genetic basis of colorectal cancer: Insights into critical pathways of tumorigenesis. Gastroenterology 2000;119:854-65.  Back to cited text no. 24
    
25.
Fearnhead NS, Britton MP, Bodmer WF. The ABC of APC. Hum Mol Genet 2001;10:721-33.  Back to cited text no. 25
    
26.
Gumbiner BM. Carcinogenesis: A balance between beta-catenin and APC. Curr Biol 1997;7:R443-6.  Back to cited text no. 26
    
27.
Peifer M. Regulating cell proliferation: As easy as APC. Science 1996;272:974-5.  Back to cited text no. 27
    
28.
Béroud C, Soussi T. APC gene: Database of germline and somatic mutations in human tumors and cell lines. Nucleic Acids Res 1996;24:121-4.  Back to cited text no. 28
    
29.
Wang JY, Hsieh JS, Chen CC, Tzou WS, Cheng TL, Chen FM, et al. Alterations of APC, c-met, and p53 genes in tumor tissue and serum of patients with gastric cancers. J Surg Res 2004;120:242-8.  Back to cited text no. 29
    
30.
Watanabe M, Kakiuchi H, Kato H, Shiraishi T, Yatani R, Sugimura T, et al. APC gene mutations in human prostate cancer. Jpn J Clin Oncol 1996;26:77-81.  Back to cited text no. 30
    
31.
Ohgaki H, Kros JM, Okamoto Y, Gaspert A, Huang H, Kurrer MO. APC mutations are infrequent but present in human lung cancer. Cancer Lett 2004;207:197-203.  Back to cited text no. 31
    
32.
Ding L, Getz G, Wheeler DA, Mardis ER, McLellan MD, Cibulskis K, et al. Somatic mutations affect key pathways in lung adenocarcinoma. Nature 2008;455:1069-75.  Back to cited text no. 32
    
33.
Furlan D, Sahnane N, Bernasconi B, Frattini M, Tibiletti MG, Molinari F, et al. APC alterations are frequently involved in the pathogenesis of acinar cell carcinoma of the pancreas, mainly through gene loss and promoter hypermethylation. Virchows Arch 2014;464:553-64.  Back to cited text no. 33
    
34.
Collins BE, Blixt O, Han S, Duong B, Li H, Nathan JK, et al. High-affinity ligand probes of CD22 overcome the threshold set by cis ligands to allow for binding, endocytosis, and killing of B cells. J Immunol 2006;177:2994-3003.  Back to cited text no. 34
    
35.
Crocker PR, Paulson JC, Varki A. Siglecs and their roles in the immune system. Nat Rev Immunol 2007;7:255-66.  Back to cited text no. 35
    
36.
Engel P, Wagner N, Miller AS, Tedder TF. Identification of the ligand-binding domains of CD22, a member of the immunoglobulin superfamily that uniquely binds a sialic acid-dependent ligand. J Exp Med 1995;181:1581-6.  Back to cited text no. 36
    
37.
Haas KM, Sen S, Sanford IG, Miller AS, Poe JC, Tedder TF. CD22 ligand binding regulates normal and malignant B lymphocyte survival in vivo. J Immunol 2006;177:3063-73.  Back to cited text no. 37
    
38.
Tedder TF, Poe JC, Haas KM. CD22: A multifunctional receptor that regulates B lymphocyte survival and signal transduction. Adv Immunol 2005;88:1-50.  Back to cited text no. 38
    
39.
Tuscano JM, Kato J, Pearson D, Xiong C, Newell L, Ma Y, et al. CD22 antigen is broadly expressed on lung cancer cells and is a target for antibody-based therapy. Cancer Res 2012;72:5556-65.  Back to cited text no. 39
    
40.
Henry DH, Costa L, Goldwasser F, Hirsh V, Hungria V, Prausova J, et al. Randomized, double-blind study of denosumab versus zoledronic acid in the treatment of bone metastases in patients with advanced cancer (excluding breast and prostate cancer) or multiple myeloma. J Clin Oncol 2011;29:1125-32.  Back to cited text no. 40
    
41.
Scagliotti GV, Hirsh V, Siena S, Henry DH, Woll PJ, Manegold C, et al. Overall survival improvement in patients with lung cancer and bone metastases treated with denosumab versus zoledronic acid: Subgroup analysis from a randomized phase 3 study. J Thorac Oncol 2012;7:1823-9.  Back to cited text no. 41
    
42.
Phillips RJ, Burdick MD, Lutz M, Belperio JA, Keane MP, Strieter RM. The stromal derived factor-1/CXCL12-CXC chemokine receptor 4 biological axis in non-small cell lung cancer metastases. Am J Respir Crit Care Med 2003;167:1676-86.  Back to cited text no. 42
    
43.
Schneider JG, Amend SR, Weilbaecher KN. Integrins and bone metastasis: Integrating tumor cell and stromal cell interactions. Bone 2011;48:54-65.  Back to cited text no. 43
    
44.
Hill A, McFarlane S, Johnston PG, Waugh DJ. The emerging role of CD44 in regulating skeletal micrometastasis. Cancer Lett 2006;237:1-9.  Back to cited text no. 44
    
45.
Peng X, Guo W, Ren T, Lou Z, Lu X, Zhang S, et al. Differential expression of the RANKL/RANK/OPG system is associated with bone metastasis in human non-small cell lung cancer. PLoS One 2013;8:e58361.  Back to cited text no. 45
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Article Figures>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed1029    
    Printed10    
    Emailed0    
    PDF Downloaded131    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]