Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2015  |  Volume : 11  |  Issue : 5  |  Page : 24-28

Decreased expression of miR-542-3p exerts growth inhibitory functions in esophageal cancer


1 Department of Medical Gastroenterology, Cancer Hospital of Henan Province, The Affiliated Cancer Hospital of Zhengzhou University, Henan 450008, PR China
2 Department of Thoracic Surgery, Cancer Hospital of Henan Province, The Affiliated Cancer Hospital of Zhengzhou University, Henan 450008, PR China

Date of Web Publication31-Aug-2015

Correspondence Address:
Dr. Su-Xia Luo
Department of Medical Gastroenterology, Cancer Hospital of Henan Province, Henan 450003
PR China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0973-1482.163834

Rights and Permissions
 > Abstract 

Objective: Identification of novel biomarkers and related molecular pathways are critical for understanding the underlying biology of human malignancies, as well as to design effective cancer therapeutics. MicroRNAs (miRNAs) are classified as a kind of short non-coding RNAs that interfere with specific target mRNAs and therefore regulate multiple biological processes. We characterized here the expression and function of miR-542-3p in esophageal squamous cell carcinoma (ESCC).
Methods: Real-time PCR was used to examine the miR-542-3p expression. After transfections of its synthetical mimics or inhibitor, cell growth rate was explored by cell counting assay. In addition, its expression was further statistically analyzed to reveal its association with clinical characters.
Results: We show that miR-542-3p, a well-characterized tumor suppressor was significantly decreased in ESCC tissues and cell lines, whose downregulation is tightly associated with tumor grade. Furthermore, forced expression of miR-542-3p suppressed cell proliferation, while silencing its expression by a synthetical inhibitor could enhance cell growth rate.
Conclusion: Taken together, our results indicated that miR-542-3p is a tumor suppressor of esophageal cancer acting at steps that regulate cell growth.

Keywords: Esophageal squamous cell carcinoma, miR-542-3p, proliferation, tumor suppressor


How to cite this article:
Chen BB, Chen XB, Bie LY, Mu Y, Wang HL, Lv HF, Li N, Ma YJ, Ding ZD, Luo SX. Decreased expression of miR-542-3p exerts growth inhibitory functions in esophageal cancer. J Can Res Ther 2015;11, Suppl S1:24-8

How to cite this URL:
Chen BB, Chen XB, Bie LY, Mu Y, Wang HL, Lv HF, Li N, Ma YJ, Ding ZD, Luo SX. Decreased expression of miR-542-3p exerts growth inhibitory functions in esophageal cancer. J Can Res Ther [serial online] 2015 [cited 2019 Nov 19];11:24-8. Available from: http://www.cancerjournal.net/text.asp?2015/11/5/24/163834

Bei-Bei Chen and Xiao-Bing Chen contribute equally to this work.



 > Introduction Top


Esophageal squamous cell carcinoma (ESCC), among the top 10 most common types of human cancers by incidence, is also a major cause of cancer-related morbidity and mortality worldwide. [1] It is the predominant sub-type in Eastern Asia and Southern Africa. Smoking, alcohol, [2] prior head and neck cancer, [3] and human papillomavirus infection [4] are risk factors of ESCC. Despite recent clinical advances, the overall 5-year survival rate for all patients with esophageal cancer is no better than a mere 20%. [5] Moreover, the diagnosis of esophageal malignancies remains to be a significant challenge. Since the cancer is located at a readily recognizable and accessible site in the body, surgery and imaging continue to play important roles in its management and offers the best chance for curing this disease. [6],[7] Hence, there is an urgent necessity to identify the underlying molecular mechanisms of ESCC. Genomic, proteomic, and molecular epidemiologic studies have greatly helped to identify potential therapeutic targets that could eventually overcome the shortcomings of the current standard therapies of esophageal cancer. [8]

MicroRNAs (miRNAs) are a class of small noncoding RNAs that always regulate target gene expression by base-pairing to its 3′ UTR region, thus repress its expression. They are single-stranded and have 19-25 nucleotides in length. miRNAs have been implicated in various biological processes, including cell proliferation, apoptosis, and differentiation. [9] Emerging evidence support a tumor suppressor or oncogene role in tumorigenesis. [10],[11] Aberrant expression of miRNAs have been reported in many human cancers, including ESCC, and may offer novel biomarkers for ESCC diagnosis, therapy, and prognosis. [12],[13] These findings highlight the putative potentials for applying miRNAs in ESCC early diagnosis and treatment.

miR-542-3p was originally investigated in 2010, in which it was known to target 3Ͳ-UTR of Survivin gene, thus leading to cell-cycle arrest and growth inhibition in lung cancer A549 cells. [14] In breast cancer, He et al. proved that angiopoietin-2 (Angpt2) was targeted by miR-542-3p. It inhibited translation of Angpt2 mRNA by binding to its 3′ UTR, and the addition of miR-542-3p to cultured endothelial cells attenuated angiogenesis. [15] Recently, in a high-throughput screen for miRNAs that modulate p53 expression, miR-542-3p was identified to enhance p53 protein stability by weakening interactions between p53 and its negative regulator MDM2. It provides another explanation to the tumor suppressor role of miR-542-3p. [16] In neuroblastoma, miR-542-3p was also reported to be down-regulated and inversely correlated with poor prognosis. Specifically, miR-542-3p exerts its tumor suppressive function in neuroblastoma, at least in part, by targeting Survivin. [17] In gastric cancer, miR-542-3p might also function as a tumor suppressor, potentially by targeting the oncogene AEG-1. It was significantly down-regulated in gastric cancer tissues and cell lines. Overexpression of miR-542-3p significantly inhibited cell growth of gastric cancer cells. [18] All these findings support a tumor suppressor function of miR-542-3p in various human malignancies. However, whether it impacts on ESCC development and progression, as well as its clinical significance and biological function remains unclear.

The objective of this study was to investigate the role of miR-542-3p in ESCC and to further explore its clinical significance. In this study, the expression of miR-542-3p was determined by quantitative real-time polymerase chain reaction (qRT-PCR) in clinical samples and cell lines. In addition, an association of miR-542-3p levels with clinicopathological factors of the ESCC patients was statistically analyzed. Functionally, we provided evidence that decreased expression of miR-542-3p contributed to ESCC tumorigenesis via inhibiting cell proliferation. Our data suggest that miR-542-3p may be useful as a diagnostic biomarker and/or a therapeutic to prevent ESCC proliferation.


 > Materials and Methods Top


Patients and tissue samples

Sixty pairs of primary ESCC and their corresponding adjacent normal tissues were obtained from ESCC patients who underwent surgery without preoperative treatment at the Cancer Hospital of Henan Province, from 2013 to 2014, were included in this study. The surgical tissues were carefully examined by a pathologist, and the final surgical pathology reports were recorded. This study was approved by the medical ethics committee of the Cancer Hospital of Henan Province. The fresh samples were snap-frozen in liquid nitrogen and stored at − 80°C until analysis.

Cell culture

Human ESCC Eca-109, Ec-9706, TE-1, TE-13, KYSE-150 and KYSE-410 cells, and human esophageal epithelial cells (HEECs) were partly ordered from the Cell Line Resource Center, Shanghai Institute of Biochemistry and Cell Biology, the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco's modified eagle's medium with 10% fetal bovine serum in a water-wormed incubator with 5% CO 2 .

MicroRNA mimics and inhibitors

MiR-542-3p mimic duplexes and miR-542-3p inhibitor oligos were synthesized by GenePharma (Shanghai, China). The cells were transfected with mimics or inhibitors by LipofectAMINE2000 (Invitrogen) as described below.

Transient transfection

Transfections were performed by using LipofectAMINE2000 (Invitrogen) as per the manufacturer's instructions. 48 h after transfection, cells were harvested for further experiments.

Real-time polymerase chain reaction

miRNAs were extracted by TRizol from the paired samples of ESCC patients. Real-time PCR was performed on applied Biosystems real-time PCR system using Ct quantization method. SYBR Premix (TOYOBO) was used to detect and quantify the expression level of miR-542-3p. U6B was an internal control. ΔCt = Ct value of miR-542-3p - Ct value of U6B. The primers are described as below:

  • hsa-miR-542-3p-F: ggcggTGTGACAGATTGATAA
  • hsa-miR-542-3p-RT: TCGTATCCAGTGCAGGGTCCGAGGTATTC GCACTGGATACGACtttcag
  • hsa-U6B-F:CGCAAGGATGACACGCAAATTCG
  • hsa-U6B-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCA CTGGATACGACA AAAATATGGAAC
  • hsa-miR-R: CAGTGCAGGGTCCGAGGT.


Cell counting

Eca-109 and KYSE-150 cells were transfected with miR-542-3p mimics or inhibitors and compared with controls for 48 h. Then cells were trypsinized and seeded into 12-well plates at a density of 10 5 cells. For the next 3 days, cells were counted by blood cell counting chamber. Counting experiments were repeated at least 3 times independently.

CCK-8 assay

CCK-8 assay was performed to test cell viability in this study. Briefly, the Eca-109 and KYSE-150 cells transfected with miR-542-3p mimics or inhibitors and compared controls were trypsinized and seeded into 96-well plates at a density of 2 × 10 3 cells in 200 μL of the full medium each well. Then the plate was incubated at 37°C with 5% CO 2 . CCK-8 assay was performed using CCK-8 Kit as per the manufacturer's instructions for the next continuous 4 days. Absorbance at 490 nm (A490) was detected by using a microplate reader. All experiments were repeated 3 times independently.

Statistical analysis

All results were analyzed with SAS version 9.2 (version 9.2) (http://www.sas.com/en_us/home.html). Data were expressed as mean ± standard deviation. The Student's t-test was performed in the analysis of differential miR-542-3p expression between cancer and normal tissues. P -value < 0.05 was considered statistically significant.


 > Results Top


MiR-542-3p is frequently down-regulated in esophageal squamous cell carcinoma tissues and cancer cell lines

We initially want to explore whether miR-542-3p might also have a role in ESCC tumorigenesis. We detected its expression level in 60 pairs of freshly resected ESCC tumors and adjacent normal tissues by qRT-PCR. Pair-wise comparison indicated that 48.3% of tumors showed >2-fold reduction of miR-542-3p expression compared to their matching controls, with only 21.7% showing an increase [Figure 1]a. Then we detected the expression of miR-542-3p in HEEC lines as shown in [Figure 1]b, compared with the immortalized HEEC, miR-542-3p was decreased in Eca-109, Ec-9706, TE-1, TE-13, KYSE-410 cell lines. However, we did not observe decreased miR-542-3p expression in KYSE-150 cells, which even showed a bit but not a significant increase. Taken together, these results suggested that down-regulation of miR-542-3p was a frequent event in ESCC.
Figure 1: Expression of miR-542-3p in esophageal squamous cell carcinoma samples and cell lines. (a) Relative expression of miR-542-3p in human esophageal squamous cell carcinoma samples and paired normal esophageal tissues. Quantitative real-time polymerase chain reaction was performed on 60 paired esophageal squamous cell carcinoma samples. The miR-542-3p expression levels were normalized to that of U6B. ΔCt(N): Ct value of miR-542-3p t value of U6B in normal tissue. ΔCt(T): Ct value of miR-542-3p t value of U6B in tumor tissue. Bar value ≤−1 indicates that the expression of miR-542-3p is down-regulated in tumors. Bar value ≥1 indicates that the expression of miR-542-3p is up-regulated in tumors. (b) Relative expression of miR-542-3p in human esophageal cells and esophageal squamous cell carcinoma cells. MiR-542-3p expression was detected in normal esophageal epithelial cell line (human esophageal epithelium cells) and six esophageal squamous cell carcinoma cell lines (Eca-109, Ec-9706, TE-1, TE-13, KYSE-150, and KYSE-410) by quantitative real-time polymerase chain reaction. U6B was used as internal control

Click here to view


The clinical significance of miR-542-3p in esophageal squamous cell carcinoma

To assess the clinical value of miR-542-3p in ESCC, the relationship between deregulated expression of miR-542-3p and clinicopathological records of these tumors was statistically analyzed. The results showed that the reduction of miR-542-3p was significantly associated with tumor grade (P < 0.05), but not with sex, age, tumor position, metastasis, and differentiation [Table 1]. These observations indicate that miR-542-3p expression is down-regulated in ESCC and is associated with this disease progression, thus might normally exert an inhibitory control on esophageal tumorigenesis.
Table 1: Correlation between miR-542-3p expression and clinicopathological features


Click here to view


The biological consequences of miR-542-3p expression in esophageal squamous cell carcinoma cells

Finally, we set to determine whether miR542-3p has the propensity to suppress esophageal cancer cell proliferation; in order to do so, we increased the expression of miR-542-3p in Eca-109 cells with miR-542-3p mimics and decreased its expression in KYSE-150 cells with miR-542-3p inhibitor [Figure 2]a and b. The expression level of miR-542-3p in miR-542-3p mimics or inhibitor -transfected cells were significantly higher or lower, respectively, compared with NC-transfected cells. Cell counting and CCK-8 cell viability assays were performed to determine the impact of miR-542-3p on cell growth in vitro. Our results demonstrated that cell population and absorbance were greatly declined when miR-542-3p was overexpressed by miR-542-3p mimics, whereas markedly elevated by miR-542-30 inhibitor, compared to that of the cells receiving nonspecific controls, over a 4-day period. Therefore, we conclude from in vitro assays that miR-542-3p is a potent anti-proliferative regulator of cultured esophageal cancer cells.
Figure 2: MiR-542-3p inhibits proliferation and viability of esophageal squamous cell carcinoma cells. (a) Eca-109 cells were transfected with miR-542-3p mimic duplexes or control duplexes. In 48 h, the cells were harvested for examining overexpression effect (left panel). Eca-109 cells were transfected with miR-542-3p mimic duplexes or control duplexes. In 24 h, cells were trypsinized and seeded into four 12-well plates at a density of 105 cells for cell counting assay or into four 96-well plates at a density of 2 × 103 cells for CCK-8 assay as described in Materials and Methods (middle panel, right panel). (b) KYSE-150 cells were transfected with miR-542-3p inhibitor oligos or control oligos. In 72 h, the cells were harvested for examining the knockdown effect (left panel). Eca-109 cells were transfected with miR-542-3p inhibitor oligos or control oligos. In 24 h, cells were trypsinized and seeded into four 12-well plates at a density of 105 cells for cell counting assay or into four 96-well plates at a density of 2 × 103 cells for CCK-8 assay (middle panel, right panel)

Click here to view



 > Discussion Top


miRNAs have been intensively reported to be involved in tumorigenesis and cancer development and proposed as promising biomarkers in cancer diagnosis. Numerous studies have observed the aberrant expression of miRNAs in esophageal cancer. [19],[20],[21],[22] In this study, we first observed that miR-542-3p was significantly down-regulated in 60 paired tissues and ESCC cell lines. Then, decreased expression of miR-542-3p was positively correlated with clinical tumor grade. Finally, in vitro functional assays demonstrated that up-regulation of miR-542-3p expression in Eca-109 cells was able to reduce cell proliferation and, in contrast, silencing its expression in KYSE-150 cells could accelerate cell growth rate. To the author's knowledge, it was the first report regarding the expression, clinical significance, and functional attributes of miR-542-3p in ESCC.

Esophageal cancer is among the most devastating disease with high mortality. Diagnosing esophageal cancer at an early stage could indeed improve overall disease-specific survival. To date, clinical management of esophageal cancer remains challenging. Regarding the underlying molecular mechanisms governing ESCC initiation and progression, little was known and much remains unknown. Therefore, there remains a vast potential for basic research. [23]

Results from the present study provided evidence that down-regulated miR-542-3p participated in malignant progression of ESCC and implicated advanced tumor grade, highlighting it as a potential therapeutic target for ESCC. This was consistent with previous reports that suggesting its tumor suppressor role. However, there is a long way to go to characterize the precise mechanisms of miR-542-3p applied to participate in ESCC progression. miRNAs execute their oncogenic or tumor suppressive functions by regulating the expression of target genes at a post-transcriptional manner. Bioinformatics analysis, as well as research assays, have identified several target transcripts of miR-542-3p, including Survivin, Angpt2, and AEG-1. [14],[15],[18] Whether it works with the same mechanism in ESCC system remains unclear. In addition, an average miRNA can have more than 100 targets, [24] and more than one miRNA can converge on a single transcript target. [25] Therefore, the potential regulatory circuitry afforded by miR-542-3p is enormous, and the accurate mechanisms on how miR-542-3p influences ESCC progression need further clarification.

Inactivation of tumor suppressors was a key rate-limiting step in the early stage of oncogenesis. Down-regulation of miR-542-3p expression was frequently found in a variety of cancers, including ESCC. But little is known about the mechanisms that induce its decrease. More attention should be paid to the upper signal that leading to its altered expression. Besides, in future studies, we should also evaluate the function of miR-542-3p in other aspects of ESCC carcinogenesis and progression, such as apoptosis inhibition and migration promotion.

In general, we revealed that miR-542-3p was frequently decreased in human ESCC. MiR-542-3p functioned as a tumor suppressor in ESCC involving in the promotion of cell proliferation. These findings may provide a novel strategy for ESCC diagnosis and therapy.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
 > References Top

1.
Chen W, Zheng R, Zhang S, Zeng H, Fan Y, Qiao Y, et al. Esophageal cancer incidence and mortality in China, 2010. Thorac Cancer 2014;5:343-8.  Back to cited text no. 1
    
2.
Blot WJ, McLaughlin JK. The changing epidemiology of esophageal cancer. Semin Oncol 1999;26:2-8.  Back to cited text no. 2
    
3.
Atabek U, Mohit-Tabatabai MA, Rush BF, Ohanian M, Rovelli P. Impact of esophageal screening in patients with head and neck cancer. Am Surg 1990;56:289-92.  Back to cited text no. 3
    
4.
Bjørge T, Hakulinen T, Engeland A, Jellum E, Koskela P, Lehtinen M, et al. A prospective, seroepidemiological study of the role of human papillomavirus in esophageal cancer in Norway. Cancer Res 1997;57:3989-92.  Back to cited text no. 4
    
5.
Siegel R, Naishadham D, Jemal A. Cancer statistics for Hispanics/Latinos, 2012. CA Cancer J Clin 2012;62:283-98.  Back to cited text no. 5
    
6.
Cools-Lartigue J, Spicer J, Ferri LE. Current status of management of malignant disease: Current management of esophageal cancer. J Gastrointest Surg 2015;19:964-72.  Back to cited text no. 6
    
7.
Schmidt T, Lordick F, Herrmann K, Ott K. Value of functional imaging by PET in esophageal cancer. J Natl Compr Canc Netw 2015;13:239-47.  Back to cited text no. 7
    
8.
Belkhiri A, El-Rifai W. Advances in targeted therapies and new promising targets in esophageal cancer. Oncotarget 2015;6:1348-58.  Back to cited text no. 8
    
9.
Farazi TA, Spitzer JI, Morozov P, Tuschl T. miRNAs in human cancer. J Pathol 2011;223:102-15.  Back to cited text no. 9
    
10.
Lan H, Lu H, Wang X, Jin H. MicroRNAs as potential biomarkers in cancer: Opportunities and challenges. Biomed Res Int 2015;2015:125094.  Back to cited text no. 10
    
11.
Taylor MA, Schiemann WP. Therapeutic Opportunities for Targeting microRNAs in Cancer. Mol Cell Ther 2014;2:1-13.  Back to cited text no. 11
    
12.
Chen ZL, Zhao XH, Wang JW, Li BZ, Wang Z, Sun J, et al. microRNA-92a promotes lymph node metastasis of human esophageal squamous cell carcinoma via E-cadherin. J Biol Chem 2011;286:10725-34.  Back to cited text no. 12
    
13.
Kong KL, Kwong DL, Chan TH, Law SY, Chen L, Li Y, et al. MicroRNA-375 inhibits tumour growth and metastasis in oesophageal squamous cell carcinoma through repressing insulin-like growth factor 1 receptor. Gut 2012;61:33-42.  Back to cited text no. 13
    
14.
Yoon S, Choi YC, Lee S, Jeong Y, Yoon J, Baek K. Induction of growth arrest by miR-542-3p that targets survivin. FEBS Lett 2010;584:4048-52.  Back to cited text no. 14
    
15.
He T, Qi F, Jia L, Wang S, Song N, Guo L, et al. MicroRNA-542-3p inhibits tumour angiogenesis by targeting angiopoietin-2. J Pathol 2014;232:499-508.  Back to cited text no. 15
    
16.
Wang Y, Huang JW, Castella M, Huntsman DG, Taniguchi T. p53 is positively regulated by miR-542-3p. Cancer Res 2014;74:3218-27.  Back to cited text no. 16
    
17.
Althoff K, Lindner S, Odersky A, Mestdagh P, Beckers A, Karczewski S, et al. miR-542-3p exerts tumor suppressive functions in neuroblastoma by downregulating Survivin. Int J Cancer 2015;136:1308-20.  Back to cited text no. 17
    
18.
Shen X, Si Y, Yang Z, Wang Q, Yuan J, Zhang X. MicroRNA-542-3p suppresses cell growth of gastric cancer cells via targeting oncogene astrocyte-elevated gene-1. Med Oncol 2015;32:361.  Back to cited text no. 18
    
19.
Ide S, Toiyama Y, Shimura T, Kawamura M, Yasuda H, Saigusa S, et al. MicroRNA-503 promotes tumor progression and acts as a novel biomarker for prognosis in oesophageal cancer. Anticancer Res 2015;35:1447-51.  Back to cited text no. 19
    
20.
Yang X, Zang W, Xuan X, Wang Z, Liu Z, Wang J, et al. miRNA-1207-5p is associated with cancer progression by targeting stomatin-like protein 2 in esophageal carcinoma. Int J Oncol 2015;46:2163-71.  Back to cited text no. 20
    
21.
Yao L, Zhang Y, Zhu Q, Li X, Zhu S, Gong L, et al. Downregulation of microRNA-1 in esophageal squamous cell carcinoma correlates with an advanced clinical stage and its overexpression inhibits cell migration and invasion. Int J Mol Med 2015;35:1033-41.  Back to cited text no. 21
    
22.
Yu T, Cao R, Li S, Fu M, Ren L, Chen W, et al. MiR-130b plays an oncogenic role by repressing PTEN expression in esophageal squamous cell carcinoma cells. BMC Cancer 2015;15:29.  Back to cited text no. 22
    
23.
Gaur P, Kim MP, Dunkin BJ. Esophageal cancer: Recent advances in screening, targeted therapy, and management. J Carcinog 2014;13:11.  Back to cited text no. 23
[PUBMED]  Medknow Journal  
24.
Brodersen P, Voinnet O. Revisiting the principles of microRNA target recognition and mode of action. Nat Rev Mol Cell Biol 2009;10:141-8.  Back to cited text no. 24
    
25.
Krek A, Grün D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, et al. Combinatorial microRNA target predictions. Nat Genet 2005;37:495-500.  Back to cited text no. 25
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Article Figures>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed1923    
    Printed23    
    Emailed0    
    PDF Downloaded90    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]