Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2015  |  Volume : 11  |  Issue : 5  |  Page : 107-111

MicroRNA-498 is downregulated in non-small cell lung cancer and correlates with tumor progression


1 Department of Oncology, The First Affiliated Hospital of Bengbu Medical College, Anhui Province, China
2 Department of Clinical Laboratory, The First Affiliated Hospital of Bengbu Medical College, Anhui Province, China

Date of Web Publication31-Aug-2015

Correspondence Address:
Dr. Yunzhi Zhai
Department of Oncology, The First Affiliated Hospital of Bengbu Medical College, Anhui Province
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0973-1482.163859

Rights and Permissions
 > Abstract 

Objective: Non-small cell lung cancer (NSCLC) is the most common type of human lung cancer, with highly aggressive, lethal malignancy and microRNAs have already been proven to be associated with NSCLC tumorigenesis. In this study, we sought to determine the expression, the clinical value and its role in NSCLC tumor progression.
Methods: Clinical NSCLC tissues and common cell lines were collected. Real-time PCR was performed to quantify the miR-498 expression. In addition, the association of miR-498 expression with clinicalpathological factors and prognosis was statistically analyzed. Furthermore, cell proliferation was measured after miR-498 was overexpressed transiently in cells.
Results: We found that miR-498 was significantly decreased in NSCLC tumors as well as cell lines, when compared with their separated controls. Decreased miR-498 expression was associated with sex, tumor type and tumor size. Functionally, ectopic expression of miR-498 in A549 and H661 cells inhibited cell proliferation.
Conclusion: Our data indicated that miR-498 is downregulated and correlated with tumor progression, which might be a putitive therapeutic target in NSCLC treatment.

Keywords: Clinicopathology, microRNA-498, non-small cell lung cancer, proliferation


How to cite this article:
Wang M, Zhang Q, Wang J, Zhai Y. MicroRNA-498 is downregulated in non-small cell lung cancer and correlates with tumor progression. J Can Res Ther 2015;11, Suppl S1:107-11

How to cite this URL:
Wang M, Zhang Q, Wang J, Zhai Y. MicroRNA-498 is downregulated in non-small cell lung cancer and correlates with tumor progression. J Can Res Ther [serial online] 2015 [cited 2019 Sep 21];11:107-11. Available from: http://www.cancerjournal.net/text.asp?2015/11/5/107/163859


 > Introduction Top


Lung cancer is now one of the leading causes of cancer-related deaths in the worldwide. [1] The majority of lung cancers are the non-small cell lung cancer (NSCLC), which accounts for about 80% of lung cancer cases. [2] NSCLC could be divided into three subtypes according to histological features: Squamous cell lung carcinoma, lung adenocarcinoma, and large-cell lung carcinoma. Despite advances and improvement in the last decades, the 5-year survival rate of NSCLC patients remains as low as 15-16% [ . [2] Surgical resection remains the only efficient therapeutic strategy for early-stage NSCLC. Since the actuality of poor understanding of NSCLC development and progression, it is clinically desired to identify novel biomarkers for NSCLC, which can accurately predict its progression and provide potential therapeutic candidates for NSCLC.

MicroRNAs (miRNAs), a class of endogenously expressed, noncoding small RNAs of approximately 22 nucleotides in length are intensively studied in the last decade. They usually suppress the expression of their target mRNAs through translational repression or mRNA cleavage. [3],[4] Growing evidence suggests that dysregulation of miRNA expression play important roles in a wide range of cancers, by regulating the cell proliferation, differentiation, apoptosis, and metastasis. [5] Meanwhile, aberrant expression of selected miRNAs have been reported to occur in human cancers, including in NSCLC, which can also serve as diagnostic or prognostic biomarkers since their significant correlation with clinicopathological features or overall survival of patients. [6],[7],[8],[9],[10] These findings highlight the putative diagnostic and therapeutic potentials in NSCLC treatment.

miRNAs-498 (miR-498) is located intergenically in 19q13.41. A high-throughput screening originally predicted miR-498 to have the capacity to target genes involved in cellular growth. [11] Notably, not until recently, one study has reported that it was downregulated in colorectal cancer and could suppress cell proliferation and lead to cell cycle arrest in G2/M phase. [12] A following research in ovarian cancer, Liu et al. found that miR-498 acted as a tumor suppressor by targeting the FOXO3 gene and inhibiting cell proliferation. [13] However, currently, still little is known about the expression of miR-498 in NSCLC, the links of its dysregulation to clinicopathological characteristics of NSCLC. In addition, functional contributions of miR-498 in NSCLC development and progression have not been experimentally established.

In the present study, we applied quantitative reverse transcription polymerase chain reaction (qRT-PCR) to determine the expression of miR-498 in 40 pairs of human NSCLC tumors paired with their adjacent normal tissues (ANT), and cell lines compared with normal bronchial epithelial cell line. Moreover, we addressed the clinical significance by analyzing the associations of miR-498 expression with clinicopathological factors of the NSCLC patients. In in vitro system, we investigated the effects of overexpression of exogenetic miR-498 on NSCLC cell proliferation ability.


 > Materials and Methods Top


Patients and tissue samples

A total of 40 patients with NSCLC who underwent surgery without preoperative treatment at the (The First Affiliated Hospital of Bengbu Medical College, Anhui Province, China), from 2014 to 2015, were included in this study. All surgical tissues were examined by a pathologist and final surgical pathology reports were obtained and recorded. This study was approved by the Medical Ethics Committee of the (The First Affiliated Hospital of Bengbu Medical College, Anhui Province, China). Written informed consent use of their samples according to the institutional regulatory requirements was received from all the patients.

Cell culture

Human NSCLC A549, H1299, sk-mes-1, YTMLC-9, H460, and H661 cells, and human bronchus epithelial Beas-2B cell were ordered from the Cell Line Resource Center, Shanghai Institute of Biochemistry and Cell Biology, The Chinese Academy of Sciences (Shanghai, China). All cells were cultured in 1640 with 10% fetal bovine serum.

MicroRNA mimics and inhibitors

miR-498 mimics duplexes and miR-498 inhibitors oligos were synthesized by GenePharma (Shanghai, China). The cells were transfected with mimics or inhibitors using RNAiMAX as described above.

Transient transfection

Transfections were performed using RNAiMAX (Invitrogen) as per the manufacturer's instructions. Forth-eight hours posttransfection, cells were harvest for further experiments.

Real-time polymerase chain reaction

miRNAs were extracted by TRizol from the tissues of NSCLC patients. Real-time PCR was performed on Applied Biosystems Real-time PCR System using Ct quantization method. SYBR Premix Ex Taq Kit (Takara) was used to detect and quantify the expression level of miR-498. U6B was as an internal control. ΔCt = Ct value of miR-498 - Ct value of U6B. The primers are as follows:

  • hsa-miR-498-F: cTTTCAAGCCAGGGGGC
  • hsa-miR-498-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACgaaaaac
  • kjskhsa-U6B-F: CGCAAGGATGACACGCAAATTCG
  • hsa-U6B-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAATATGGAAC
  • hsa-miR-R: CAGTGCAGGGTCCGAGGT.


Cell counting

A549 cells were transfected with control or miR-498 mimics and control or miR-498 inhibitors for 48 h. Then cells were trypsinized and seeded into 12-well plates at a density of 10 5 cells. For the next 3 days, cells were counted by blood cell counting chamber. Counting experiments were repeated at least 3 times independently.

Cell-counting kit 8 assay

Cell-counting kit 8 (CCK-8) assay was carried out in this study. Briefly, the H661 cells transfected with control or miR-498 mimics and control or miR-498 inhibitors were trypsinized and seeded into 96-well plates at a density of 2000 cells in 200 μl of medium per well and then incubated at 37°C. Then CCK-8 assay was performed using CCK-8 Kit as per the manufacturer's instructions for 4 days. Absorbance was detected at 490 nm using a microplate reader. Experiments were repeated 3 times independently.

Crystal violet staining

YTMLC-9 cells grown in plates were fixed in 4% paraformaldehyde for 20 min. After wash, the cells were stained with crystal violet solution for 30 min. The plates were aspirated, washed, and allowed to air dry. Finally, the plates were scanned with high resolution.

Statistical analysis

All results were analyzed with SAS 9.2 (http://www.sas.com/en_us/home.html). Data were expressed as mean ± standard deviation. The Student's t-test was performed in the analysis of differential miR-498 expression between tumor and normal tissues. P < 0.05 was considered as statistically significant.


 > Results Top


Decreased expression of miRNAs-498 in non-small cell lung cancer tissues and cell lines

To access the role of miR-498 in NSCLC tumorigenesis, we firstly performed qRT-PCR to determine its expression in 40 pairs of clinical NSCLC tissues. As shown in [Figure 1]a, miR-498 was significantly decreased in NSCLC tissues (P < 0.05) than that of the corresponding normal lung tissues. Pair-wise comparison revealed that nearly 43% of tumors showed >2-fold reduction of miR-498 expression compared to their matching controls, with only 10 pairs showing more than 2-fold increase. To verify this reduced expression in tissues, we also detect its expression in a number of human NSCLC cell lines, including A549, H1299, SK-MES-1, YTMLC-9, H460, and H661 cells, when compared to that in the normal bronchus epithelial Bears-2B cells [Figure 1]b. Accordingly, the results also showed a decreased expression of miR-498. The downregulated expression of miR-498 might indicate its inhibitory effect on NSCLC cells.
Figure 1: Decreased expression of microRNA-498 in non-small cell lung cancer tissues and cell lines. (a) Pair-wise comparison of microRNA-498 expression between 40 cases of non-small cell lung cancer tissues and adjacent nontumor lung tissues by quantitative reverse transcription polymerase chain reaction showing microRNA-498 expression was reduced in 42.5% of the samples. microRNA-498 expression levels were calculated by the 2−ƒ¢Ct method and normalized to U6 small nuclear RNA. (b) Relative expression of microRNA-498 in six non-small cell lung cancer cell lines and a normal human bronchial epithelial cell line (Beas-2B)

Click here to view


Correlation of miRNAs-498 levels with the clinicopathological factors

We next want to explore the clinical value of altered expression of miR-498 in NSCLC tissues. The association of miR-498 levels with the clinicopathological factors of the above referred 40 patients was statistically analyzed by κ2 test [Table 1]. The results showed that, decreased miR-498 levels were positively and significantly correlated with sex (P < 0.05), tumor type (P < 0.05), and T stage (P < 0.001). However, miR-498 expression was not found to be associated with age, N stage, and M stage. Taken together, these observations suggested that altered expression of miR-498 might be negatively correlated with NSCLC progression.
Table 1: Correlation between miR - 498 expression and clinicopathological features


Click here to view


miRNAs-498 inhibited non-small cell lung cancer cell proliferation in vitro

To determine if miR-498 has the capacity to inhibit NSCLC tumorigenesis, we introduced a synthetical miR-498 mimics or inhibitor, to alter the level of total miR-498 in A549 or H661 cells, respectively, and monitored the rate of cell growth by cell counting, using CCK-8 kit and crystal violate staining. As shown in [Figure 2]a, qRT-PCR confirmed the elevated or reduced level of miR-498 in the transfected cells. Results from the cell proliferation monitoring assays indicated that the growth rate of these cells was reduced markedly in miR-498 mimics group compared to that of the cells receiving nonspecific control mimics. Oppositely, cell growth rate was accelerated significantly in miR-498 inhibitor transducing group than the matched control group over a 4-day period [Figure 2]b-d.
Figure 2: microRNA-498 inhibits cell proliferation in non-small cell lung cancer cell lines in vitro. (a) Total levels of microRNA-498 in A549 cells transfected with the synthetic mimics of microRNA-498 (left panel), and H661 cells transfected with inhibitor of microRNA-498 (right panel). Quantitative reverse transcription polymerase chain reaction was carried out to detect the expression of microRNA-498. U6 RNA was used as an internal control. Cell counting method (b), cell counting kit 8 (c), and crystal violate staining method (d) were performed to access cell growth rates of the cell lines described in (a) over a 4-day period. Data are expressed as the mean standard deviation of the experiments performed in triplicate. *P < 0.05, **P < 0.01. The results showed that forced expression of microRNA-498 suppressed cell proliferation, while inhibition of microRNA-498 had the opposite effect

Click here to view



 > Discussion Top


Although recent improvements in clinical diagnosis and treatment of NSCLC patients over the last decades, only modest advances have been seen in overall 5-year survival for most NSCLC patients since 1970s. [14] One of the major obstacles is the lacking of precise molecular mechanisms of NSCLC progression, especially the events occurred in the early stage of this disease. Therefore, it is of great importance to investigate the underlying mechanisms of NSCLC tumorigenesis, and to identify novel genetic or protein biomarkers for accurate diagnosis and prediction of prognosis to improve postoperative treatment strategies. [15] miRNAs were intensively studied recently and provided novel possibilities for NSCLC curity, since they are often aberrant expressed and associate well with some clinicopathological features of NSCLC. [16],[17],[18] Importantly, they have been proved to play crucial roles as oncogenes or tumor suppressors in NSCLC, as well as in other types of cancer. [19],[20],[21],[22]

Previous evidence of miR-498 as a tumor suppressor has only been reported in two types of cancers: Gopalan et al. initially found that miR-498 was downregulated in colorectal tissues from 80 patients with surgical resection of colorectum. Moreover, the colon cancer cell lines showed reduced expression of miR-498 compared to a normal colonic epithelial cell line, which also supports our results. Furthermore, they demonstrated that mimic driven overexpression of miR-498 in the SW480 cell line resulted in reduced cell proliferation and increased proportions of G2-M phase cells. [12] Immediately, Liu et al. reported the reduced expression of miR-498 in ovarian cancer cells and ovarian cancer tissues compared with human ovary surface epithelial cells and the matched tumor ANT. Similarly, its overexpression could also promote cell proliferation in ovarian cancer. In addition, they identified FOXO3 as a direct target of miR-498. [13] All these findings indicated that miR-498 may function as a tumor suppressor in various cancers. However, to our knowledge, the expression and clinical significance of miR-498 in NSCLC has not been addressed yet.

This study found a significant low expression of miR-498 in NSCLC tissues compared to adjacent noncancerous lung tissues, which has not been reported before. We also found that decreased miR-498 levels tended to be associated with sex, tumor type, and T malignancy staging. As a result, miR-498 may be a potential biomarker for diagnosis for NSCLC. At last, in vitro assays demonstrated that forced expression of miR-498 expression in A549 cells was able to reduce the cell growth rate. In the other hand, inhibiting miR-498 expression in H661 cells was able to promote cell proliferation ability. To the authors' knowledge, this is the first report regarding the clinical significance and functional attributes of miR-498 in NSCLC.

However, neither we had identified the underlying molecular mechanisms of the indicated phenotype, nor determined its effects on NSCLC cell apoptosis and metastasis. In future studies, more attention should be paid on its targets in NSCLC, as well as the signaling pathways it might influence on. We should also consider its roles in other aspects of NSCLC tumorigenesis. Further studies and more samples will be required to confirm the prognostic value of miR-498 in NSCLC.

In summary, we demonstrated that miR-498 may serve as a meaningful diagnostic biomarker and potential therapeutic target in NSCLC treatment. Our findings may have a therapeutic potential to suppress NSCLC cell proliferation.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
 > References Top

1.
Zheng R, Zeng H, Zhang S, Fan Y, Qiao Y, Zhou Q, et al. Lung cancer incidence and mortality in China, 2010. Thorac Cancer 2014;5:330-6.  Back to cited text no. 1
    
2.
Goldstraw P, Ball D, Jett JR, Le Chevalier T, Lim E, Nicholson AG, et al. Non-small-cell lung cancer. Lancet 2011;378:1727-40.  Back to cited text no. 2
    
3.
Ling H, Fabbri M, Calin GA. MicroRNAs and other non-coding RNAs as targets for anticancer drug development. Nat Rev Drug Discov 2013;12:847-65.  Back to cited text no. 3
    
4.
Krol J, Loedige I, Filipowicz W. The widespread regulation of microRNA biogenesis, function and decay. Nat Rev Genet 2010;11:597-610.  Back to cited text no. 4
    
5.
Farazi TA, Spitzer JI, Morozov P, Tuschl T. miRNAs in human cancer. J Pathol 2011;223:102-15.  Back to cited text no. 5
    
6.
Tafsiri E, Darbouy M, Shadmehr MB, Zagryazhskaya A, Alizadeh J, Karimipoor M. Expression of miRNAs in non-small-cell lung carcinomas and their association with clinicopathological features. Tumour Biol 2015;36:1603-12.  Back to cited text no. 6
    
7.
Wang RJ, Zheng YH, Wang P, Zhang JZ. Serum miR-125a-5p, miR-145 and miR-146a as diagnostic biomarkers in non-small cell lung cancer. Int J Clin Exp Pathol 2015;8:765-71.  Back to cited text no. 7
    
8.
Ge H, Li B, Hu WX, Li RJ, Jin H, Gao MM, et al. MicroRNA-148b is down-regulated in non-small cell lung cancer and associated with poor survival. Int J Clin Exp Pathol 2015;8:800-5.  Back to cited text no. 8
    
9.
Xie Z, Cai L, Li R, Zheng J, Wu H, Yang X, et al. Down-regulation of miR-489 contributes into NSCLC cell invasion through targeting SUZ12. Tumour Biol 2015. [Ahead of print].  Back to cited text no. 9
    
10.
Chen D, Guo W, Qiu Z, Wang Q, Li Y, Liang L, et al. MicroRNA-30d-5p inhibits tumour cell proliferation and motility by directly targeting CCNE2 in non-small cell lung cancer. Cancer Lett 2015;362:208-17.  Back to cited text no. 10
    
11.
Leivonen SK, Sahlberg KK, Mäkelä R, Due EU, Kallioniemi O, Børresen-Dale AL, et al. High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol Oncol 2014;8:93-104.  Back to cited text no. 11
    
12.
Gopalan V, Smith RA, Lam AK. Downregulation of microRNA-498 in colorectal cancers and its cellular effects. Exp Cell Res 2015;330:423-8.  Back to cited text no. 12
    
13.
Liu R, Liu F, Li L, Sun M, Chen K. MiR-498 regulated FOXO3 expression and inhibited the proliferation of human ovarian cancer cells. Biomed Pharmacother 2015;72:52-7.  Back to cited text no. 13
    
14.
Marshall E. Cancer research and the $90 billion metaphor. Science 2011;331:1540-1.  Back to cited text no. 14
[PUBMED]    
15.
Dekker A, Vinod S, Holloway L, Oberije C, George A, Goozee G, et al. Rapid learning in practice: A lung cancer survival decision support system in routine patient care data. Radiother Oncol 2014;113:47-53.  Back to cited text no. 15
    
16.
Xu C, Zheng Y, Lian D, Ye S, Yang J, Zeng Z. Analysis of microRNA expression profile identifies novel biomarkers for non-small cell lung cancer. Tumori 2015;101:104-10.  Back to cited text no. 16
[PUBMED]    
17.
Lv J, Xu L, Xu Y, Qiu M, Yang X, Wang J, et al. Expression of MiRNA-221 in non-small cell lung cancer tissues and correlation with prognosis. Zhongguo Fei Ai Za Zhi 2014;17:221-5.  Back to cited text no. 17
    
18.
Gao W, Xu J, Shu YQ. miRNA expression and its clinical implications for the prevention and diagnosis of non-small-cell lung cancer. Expert Rev Respir Med 2011;5:699-709.  Back to cited text no. 18
    
19.
Du L, Zhao Z, Ma X, Hsiao TH, Chen Y, Young E, et al. miR-93-directed downregulation of DAB2 defines a novel oncogenic pathway in lung cancer. Oncogene 2014;33:4307-15.  Back to cited text no. 19
    
20.
Shen S, Yue H, Li Y, Qin J, Li K, Liu Y, et al. Upregulation of miR-136 in human non-small cell lung cancer cells promotes Erk1/2 activation by targeting PPP2R2A. Tumour Biol 2014;35:631-40.  Back to cited text no. 20
[PUBMED]    
21.
Wang H, Guan X, Tu Y, Zheng S, Long J, Li S, et al. MicroRNA-29b attenuates non-small cell lung cancer metastasis by targeting matrix metalloproteinase 2 and PTEN. J Exp Clin Cancer Res 2015;34:59.  Back to cited text no. 21
    
22.
Yang T, Thakur A, Chen T, Yang L, Lei G, Liang Y, et al. MicroRNA-15a induces cell apoptosis and inhibits metastasis by targeting BCL2L2 in non-small cell lung cancer. Tumour Biol 2015. [Ahead of print].  Back to cited text no. 22
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Article Figures>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed1663    
    Printed23    
    Emailed0    
    PDF Downloaded163    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]