Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2013  |  Volume : 9  |  Issue : 1  |  Page : 22-24

A preliminary study on the radiation-resistance mechanism in ovarian cancer


1 Department of Gynaecology and Obstetrics, Second Teaching Hospital of Jilin University,Changchun; Department of Gynaecology and Obstetrics, The Da Qing Long Nan Hospital, Daqing, HeiLong Jing, China
2 Laboratory of TANG Ao-qing Distinguished Professor, China-Japan Union Hospital of Jilin University, Changchun, P. R, China
3 Department of Gynaecology and Obstetrics, The Da Qing Long Nan Hospital, Daqing, HeiLong Jing, China
4 Department of Radiotherapy, Second Teaching Hospital of Jilin University, Changchun, China
5 Department of Gynaecology and Obstetrics, Second Teaching Hospital of Jilin University, Changchun, China

Date of Web Publication10-Apr-2013

Correspondence Address:
Yu-bing Chen
Second Clinical Hospital of Jilin University, 218 Ziqiang street, Changchun 130041, P. R
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0973-1482.110346

Rights and Permissions
 > Abstract 

Aim: The present study was designed to explore the radiation-resistance mechanism by interfering in checkpoints kinase 1 (CHK1) and DNA-activated protein kinase (DNA-PK) genes with short hairpin RNA (shRNA) transfection into Skov3 cells derived from ovarian cancer and HeLa cells derived from cervical cancer.
Materials and Methods: The cultured Skov3 and HeLa cells were transfected with plasmid vectors containing CHK1 shRNA and DNA-PK shRNA, respectively, through Lipofectimine™ 2000 mediation, and cultured for 20 hours before exposure to 2 Gy X-radiation. The cells were harvested 4 and 28 after X-irradiation respectively then washed 3 times with PBS. These cells were stained with Annexin V/PI and applied by flow cytometer to analyze alteration of apoptosis with software CellQuest.
Results: The apoptotic response in Skov3 cells to X-radiation was significantly lower than that in HeLa cells at 4 hour (t = 15.22, P < 0.001) and 28 hours (t = 15.78, P < 0.001) of post-irradiation. The shRNA might not affect the apoptosis of Skov3 and HeLa cells, while shRNA-transfection significantly enhanced the apoptotic response in Skov3 cells to X-radiation as compared with that in HeLa cells.
Conclusions: The present work suggests that the CHK1 and DNA-PK genes are very likely to play a role in developing a radiation resistance in ovarian cancer.

Keywords: Checkpoints kinase 1, DNA-activated protein kinase, ovarian cancer, radiation resistance, small hairpin RNA


How to cite this article:
Liao Q, Zhang Hm, Li Hh, Zhou R, Mao Hl, Chen Yb, Cui MH. A preliminary study on the radiation-resistance mechanism in ovarian cancer. J Can Res Ther 2013;9:22-4

How to cite this URL:
Liao Q, Zhang Hm, Li Hh, Zhou R, Mao Hl, Chen Yb, Cui MH. A preliminary study on the radiation-resistance mechanism in ovarian cancer. J Can Res Ther [serial online] 2013 [cited 2019 Sep 15];9:22-4. Available from: http://www.cancerjournal.net/text.asp?2013/9/1/22/110346


 > Introduction Top


Ovarian cancer is a common malignant tumor in women and a leading cause of death among all gynecological malignant tumors. As compared with cervical carcinoma, the patients with ovarian cancer have a poor response to radiotherapy, leading to the unsatisfactory therapeutic effect in clinical oncology. [1],[2],[3] The killing effect of radiation on tumor cells is mainly by destruction of DNA in cells, also known as DNA damage response (DDR). [4] DDR is a process involved in the complicated network regarding a multiple signal conduction pathway, such as cell cycle check, regulation of DNA repair, apoptosis and genome integrity. [5] Damaged DNA activates the DNA damage response kinase [ataxia telangiectasia mutated gene (ATM) protein or AT and Rad3 related gene (ATR) protein] that controls cell cycle check, retardation of cell cycle course and repairing of damaged DNA. [6] The key enzyme related to DNA repair, DNA-activated protein kinase (DNA-PK), can determine the prognosis of cells. [7] Successful DNA repair can restore cells into the normal cycle of life, but failure to get damaged DNA accurately repaired will initiate an apoptotic process. Therefore, it is important to explore how the cells resistant to radiation are responding to DNA damaging and repairing. Accordingly, the present work was undertaken to investigate the mechanism by which Skov 3 cells derived from ovarian cancer could resist radiation in comparison with Hela cells derived from cervical cancer. In this study, we also applied short hairpin RNA (shRNA) to interfere in the activities of checkpoint kinase 1 (CHK1) and DNA-PK in X-irradiated Skov3 and HeLa cells in order to identify a new pathway useful for the development of clinical treatment on ovarian cancer.


 > Materials and Methods Top


Both Skov3 and HeLa cells were suspended in DMEM media containing 10% fetal calf serum (FCS), penicillin (100 U/ml) and streptomycin (100 μg/ml) and were then seeded in 6-well plates at 3 × 10 5 cells/well and cultured in a CO 2 incubator at 37°C with 5% CO 2 .

To interfere in the activities of CHK1 and DNA-PK, the GGAATAGTACTTACTGCAATG sequence presented in the CHK1 gene and the GCATTGGAATTATCTCAAAGC sequence in the DNA-PK gene were used as the targets of shRNA inserted into a plasmid vector. The cDNA reversely transcripted by the GTTCTCCGAACGTGTCACGT sequence that is not relevant to either CHK1 shRNA or DNA-PK shRNA was used to construct a control plasmid vector, named shNC. The accuracy of constructed vectors was confirmed by digestion with restriction enzyme and sequencing. Transfection of the shRNA-containing plasmid vectors into Skov3 and Hela cells was mediated by liposome (Lipofectimine™ 2000, Invitrogen) in a ratio of vector plasmid (2 μg) to liposome (5 μl) based on the manufacturer's instruction.

The cells transfected with shRNA were cultured for 20 hours before exposure with 2 Gy X-radiation. A deep X-ray therapy apparatus was used to irradiate the cells with 200 kV, 10 mA, filter 0.5 mm Cu and 1.0 mm Al; the dose rate used for irradiation was 0.287 Gy/min. The X-irradiated cells then continued to culture at 37°C with 5% CO 2 .

The cells were harvested 4 and 28 hours, respectively after X-irradiation then washed 3 times with PBS. These cells were stained with Annexin V/PI and PI, and a flow cytometer FACSCalibur, BD was applied to analyze alteration of apoptosis with software CellQuest, Modifit. All the data were expressed in a fold change (FC) which was the ratio of the apoptotic rate of treated cells to that of control cells. In [Table 1], FC = the apoptotic rate of X-irradiated cells/the apoptotic rate of sham-irradiated cells; In [Table 2], FC = the apoptotic rate of shRNA-transfected cells/the apoptotic rate of shNC-transfected cells; In [Table 3], FC = the apoptosis radio in shRNA-transfected cells of post-radiation/the apoptosis radio in shNC-transfected cells of post-radiation.
Table 1: Effects of X-irradiation on apoptosis in Skov 3 and Hela cells

Click here to view
Table 2: Effects of shRNA-transfection on apoptosis in the cells receiving sham-irradiation

Click here to view
Table 3: Effects of X-irradiation on apoptosis ratio in shRNA-transfected cells (mean±SD, n = 6)

Click here to view


Statistic analysis was performed using SPSS 14.0 software. The Student's t-test was applied to analyze the difference in the FC between Skov3 and Hela cells.


 > Results Top


The analysis with flow cytometry demonstrated that the apoptotic response to X-radiation in Skov3 cells was significantly lower than that in HeLa cells at 4 (t = 15.22, P < 0.001) and 28 hours (t = 15.78, P < 0.001) of post-radiation, suggesting that Skov3 cells are strongly resistant to X-radiation [Table 1].

As shown in [Table 2], a significant difference in apoptosis was observed between Skov 3 and HeLa cells which were transfected with DNA-PK-targeting shRNA only 28 hours after sham-irradiation (t = 3.51, P = 0.007). This result suggests that shRNA transfection may not significantly affect the apoptosis in 2 kinds of cells.

In shRNA-transfected cells, the apoptotic response in Skov 3 cells to X-radiation was significantly increased as compared with that in Hela cells [Table 3], however such an increased response was not observed in DNA-PK shRNA-transfected cells at 28 hours of post-radiation (t = 0.96, P = 0.360).


 > Discussion Top


DNA damage response (DDR) is a conservative mechanism of cells against any DNA damage induced by external and internal factors. It means that the cells collect a large number of proteins rapidly, when DNA damage occurs, to amplify and transmit DNA damage signals. These proteins cluster at DNA double-strand break (DSB) and become the DSB signals. DDR represents a complex network of multiple signaling pathways involving cell cycle checkpoints, DNA repair, transcriptional regulation, apoptosis and so on. These processes maintain the genomic integrity following various endogenous (metabolic) or environmental stresses. The killing effect of ionizing radiation on tumor cells is mainly based on the DDR mechanism. If tumor cells fail to cope with radiation-induced DNA damage, they will be highly sensitive to radiotherapy. Therefore, an inhibition of DDR in cancer cells may be a promising way to enhance their sensitivity to radiotherapy or even chemotherapy. Nowadays, infact quite a few DDR inhibitory agents have already been used in clinical for radiotherapy and chemotherapy. [8],[9]

Phosphatidylinositol kinase-related kinases (PIKKs) have numerous family members, including ataxia telangiectasia mutated gene (ATM) protrin, AT and Rad-3 related gene (ATR) protein and DNA-dependent protein kinase (DNA-PK), which are crucial members of the PIKKs family. Once DNA damage occurs, ATM or ATR [10] activates the unique cell cycle checkpoints to block tumor cells entering the S phase (the G 1 /S-phase checkpoint), to delay S phase progression (the intra-S or S-phase checkpoint) or prevent mitotic entry (the G 2 /M-phase checkpoint). [11] A series of phosphorylation cascades are initiated after DNA-PK activation, slowing down the process of cell cycle or even temporarily retarding the cell cycle, so that the cells can get enough time to repair and avoid passing on to the next generation. DSB is the most serious type of DNA damage. It can cause chromosomal inversion, gene loss, or even cell death. Non-homologous end-joining (NHEJ) is the principal pathway of repairing DSB, and DNA-PK is the key enzymes of the repairing process because its phosphorylation is essential for NHEJ-related DNA repairs. [7]

Checkpoint kinase 1 (CHK1) is a highly conserved serine/threonine protein kinase. When DNA synthesis is inhibited, the activated phosphorylation CHK1 can reactivate the blocked origin of late replication and ensure the integrity of the replication fork which has been arrested. The G 2 phase checkpoint is regulated mainly through the ATR-CHK1- CDC25C pathway. When DNA replication is blocked, the helicase continues to unlock the DNA double-strand, then the single-stranded DNA-replication protein A forms. This complex can raise ATR through ATR-interacting protein, at the same time raise and activate Rad 17 and Rad9-Rad1-Hus1, combining them to the replication fork. Topoisomerase II bindingprotein binds with Rad 9-1-1 to activate ATR, then the activated ATR phosphorylates the Rad 17 and Rad 9-1-1. Thus the signal is further passed to the downstream.

As above-mentioned in [Table 1], ovarian cancer is more strongly resistant to all kinds of radiotherapy than cervical cancer. [1],[2],[3] The present work suggests that the CHK1 and DNA-PK genes are very likely to play a role in developing the radiation resistance in ovarian cancer. [Table 2] and [Table 3] show that the inhibition of DNA-PK and CHK1 expressions may enhance the sensitivity of ovarian cancer cells to ionizing radiation. Because CHK1 and DNA-PK involve in the DDR process, including the identification of DNA-damaged position, the initiation of a repair process as well as the control of transcription and apoptosis, we suppose that the CHK1 and DNA-PK genes are very likely to play an important role in developing the radiation resistance in ovarian cancer. Besides we believe that the in-depth study of DNA-PK and CHK1 may provide more effective gene targets and broader prospects for the sensitization of radiotherapy and chemotherapy.

 
 > References Top

1.Jemal A, Siegel R, Ward E, Murray T, Xu J, Thun MJ. Cancer statistics. CA Cancer J Clin 2007; 57:43-66.  Back to cited text no. 1
    
2.Gilks CB, Ionescu DN, Kalloger SE, Köbel M, Irving J, Clarke B, et al. Tumor cell type can be reproducibly diagnosed and is of independent significance in patients with maximally debulked ovarian carcinoma. Hum Pathol 2008; 39:1239-51.  Back to cited text no. 2
    
3.Köbel M, Kalloger SE, Boyd N, McKinney S, Mehl E, Palmer C, et al. Ovarian carcinoma subtypes are different diseases: Implications for biomarker studies. PLoS Med 2008;5:e232.  Back to cited text no. 3
    
4.Ciccia A, Elledge SJ. The DNA damage response: Making it safe to play with knives. Mol Cell 2010; 40:179-204.  Back to cited text no. 4
    
5.Bartek J, Lukas J. DNA damage checkpoints: From initiation to recovery or adaptation. Curr Opin Cell Biol 2007; 19:238-45.  Back to cited text no. 5
    
6.Smith J, Tho LM, Xu N, Gillespie DA. The ATM-Chk2 and ATR-Chk1 pathways in DNA damage signaling and cancer. Adv Cancer Res 2010; 108:73-112.  Back to cited text no. 6
    
7.Helleday T, Petermann E, Lundin C, Hodgson B, Sharma RA. DNA repair pathways as targets for cancer therapy. Nat Rev Cancer 2008; 8:193-204.  Back to cited text no. 7
    
8.Martin SA, Lord CJ, Ashworth A. DNA repair deficiency as a therapeutic target in cancer. Curr Opin Genet Dev 2008;18:80-6.  Back to cited text no. 8
    
9.Sancar A, Lindsey-Boltz LA, Unsal-Kaçmaz K, Linn S. Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu Rev Biochem 2004;73:39-85.  Back to cited text no. 9
    
10.Lobrich M, Jeggo PA. The impact of a negligent G 2 /M checkpoint on genomic instability and cancer induction. Nat Rev Cancer 2007;7:861-9.  Back to cited text no. 10
    
11.Shrivastav M, De Haro LP, Nickol off JA. Regulation of DNA double-strand break repair path way choice. Cell Res 2008;18:134-47.  Back to cited text no. 11
    



 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed2060    
    Printed62    
    Emailed0    
    PDF Downloaded166    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]