About us  |   Ahead of print   |   Current Issue   |   Archives  |   Search  |   Instructions   |    Subscribe   |    Submit Article   |    Advertise   |    Feedback   |    Top cited   |    e-Alerts
Journal of Cancer Research and Therapeutics
The official publication of Association of Radiation Oncologists of India (AROI)  
JCRT is now indexed with PubMed / MEDLINE.
 Login    Print this page Email this page   Small font sizeDefault font sizeIncrease font size
 
  Search
 
  
 >  Similar in PUBMED
 »  Search Pubmed for
 »  Search in Google Scholar for
 »Related articles
 >  Article in PDF (392 KB)
 >  Citation Manager
 >  Access Statistics
 >  Reader Comments
 >  Email Alert *
 >  Add to My List *
* Registration required (free)  

 
 >  Abstract
 > Introduction
 >  Materials and Me...
 > Results
 > Discussion
 > Conclusions
 > Acknowledgements
 >  References
 >  Article Figures

 Article Access Statistics
    Viewed1399    
    Printed61    
    Emailed2    
    PDF Downloaded239    
    Comments [Add]    

Recommend this journal

 


 
   Table of Contents  
ORIGINAL ARTICLE
Year : 2012  |  Volume : 8  |  Issue : 2  |  Page : 226-231
 

Downregulation of gene MDR1 by shRNA to reverse multidrug-resistance of ovarian cancer A2780 cells


1 Department of Pathogenic Biology and Immunology, Zhongda Hospital, Medical School, Southeast University, Nanjing, 210009, China
2 Department of Gynecology and Obstetrics, Zhongda Hospital, Medical School, Southeast University, Nanjing, 210009, China

Date of Web Publication26-Jul-2012

Correspondence Address:
Jun Dou
Department of Pathogenic Biology and Immunology, Medical School, Southeast University, Nanjing 210009
China
Login to access the Email id


DOI: 10.4103/0973-1482.98975

Get Permissions

 
 > Abstract 

Background: To explore the effects of downregulated multidrug-resistance P-glycoprotein (MDR1/ABCB1) and reversed multidrug-resistance in human A2780 ovarian cancer cells.
Materials and Methods: Three shRNAs targeting the MDR1 gene were synthesized, and cloned into plasmid pSUPER-enhanced green fluorescent protein 1 (EGFP1). The formed pSUPER-EGFP1-MDR1-shRNAs were transfected into the A2780 cells, respectively, and the quantitative reverse transcription polymerase chain reaction and western blot were used respectively to determine the MDR1 expression. The multidrug-resistance (MDR) of the MDR1-shRNAs transfected A2780 cells to chemotherapy drugs in vitro and in tumor-bearing nude mice were respectively evaluated.
Results: The MDR1 shRNA expression resulted in decreased P-glycoprotein expression in the transfected A2780 cells. The MDR1-shRNA2 transfected cells showed that the sensitivities to chemotherapy drugs were higher than other shRNAs transfected A2780 cells, and that the formed tumor in mice grew slower than those of other mice after paclitaxel was injected into tumor-bearing nude mice.
Conclusions: Our data demonstrates that the RNA interference could knock down gene MDR1 and reduce the P-glycoprotein expression, and partly reverse the MDR of A2780 cells in vitro and in vivo. These results suggest that MDR-1 is an effective therapeutic target for human ovarian caner treatment.


Keywords: Multidrug-resistance P-glycoprotein, multidrug-resistance, ovarian cancer cells, small hairpin RNA, target therapy


How to cite this article:
Zhang H, Wang J, Cai K, Jiang L, Zhou D, Yang C, Chen J, Chen D, Dou J. Downregulation of gene MDR1 by shRNA to reverse multidrug-resistance of ovarian cancer A2780 cells. J Can Res Ther 2012;8:226-31

How to cite this URL:
Zhang H, Wang J, Cai K, Jiang L, Zhou D, Yang C, Chen J, Chen D, Dou J. Downregulation of gene MDR1 by shRNA to reverse multidrug-resistance of ovarian cancer A2780 cells. J Can Res Ther [serial online] 2012 [cited 2013 May 25];8:226-31. Available from: http://www.cancerjournal.net/text.asp?2012/8/2/226/98975



 > Introduction Top


Ovarian epithelial carcinoma is the most common form of ovarian cancer and the incidence rate of ovarian cancer ranks the third in all the gynecological cancer of China, following cervical cancer and uterine cancer. [1] The poor outcome of women with late-stage ovarian cancer underscores the need for early detection strategies and to develop new treatment options. [2],[3] However, relatively little is known about the molecular events that lead to the development of this highly aggressive disease. [3],[4] The original therapeutic approaches including operation, chemotherapy, radiotherapy, immunotherapy and physiotherapy are to think ovarian cancer as a homogeneous bulk, and the therapeutic goal is to reduce the quantity of cancer cells or to improve the survival rate of patients with this disease. Unfortunately, these therapies may cause the tumor relapse due to chemo/radio-resistance of a part of the tumor cells. Overwhelming evidence shows that the multidrug resistance MDR1/P-glycoprotein (P-gp) called as ABCB1, a 170-kDa membrane phosphor-glycoprotein, coded by the multidrug resistance type I (MDR1/ABCB1) gene located on chromosome 7q21, is an energy-dependent efflux pump and functions in the extrusion of drugs from the tumor cells and in decreased intracellular accumulation of anticancer drugs that can be a cause of failure of anticancer chemotherapy. [5],[6],[7]

It is thus clear that the drug transporter Pgp is closely associated with tumor resistance. The expression of Pgp is found in primary and metastatic ovarian cancer cells and ovarian cancer cell line, and the Pgp overexpression can be a cause of failure of anticancer chemotherapy. [6] To our knowledge, most anticancer drugs that efficiently reverse MDR1-mediated multidrug resistance (MDR) have only low affinity for Pgp and there are only a few effective and relatively specific Pgp inhibitors available. Therefore, there have been ongoing efforts to develop more effective therapeutic method for ovarian cancer treatment. [8],[9],[10]

Recently, a study of using microRNAs (miRNAs) to modulate MDR1/Pgp expression in human ovarian cancer cells demonstrated that the upregulation of miR-27a expression resulted in downregulation of Pgp expression and the decrease of paclitaxel-resistant ovarian cancer cell line A2780/Taxol as compared with its parental line A2780. [11] Herewith, we introduced a small interfering RNA (siRNA) approach to directly target MDR1 by vector-based small hairpin RNA (shRNA) in human ovarian cancer cell line A2780, and examined the chemotherapy resistance to chemotherapeutic agents such as vincristine, paclitaxel, daunomycin and cisplatin between the A2780 cells and the MDR1-shRNAs transfected A2780 cells, respectively in vitro. Simultaneously, we also observed the drug resistance to paclitaxel in the Balb/c nude mice bearing A2780 ovarian cancer model after the tumor was treated with paclitaxel. Our data show that the constructed MDR1-shRNA2 effectively downregulate the expressions of MDR1 mRNA and Pgp protein in the A2780 cell line and markedly inhibited tumor growth by injection of paclitaxel into peritoneal cavity of ovarian cancer-bearing nude mice. These results suggest that RNAi can knock down gene MDR-1 and enhance the chemotherapy sensitivities to anticancer drugs in ovarian cancer cells.


 > Materials and Methods Top


Balb/c nude mice (weights: 16-18 g and ages between 5 and 6 weeks) were ordered from the Animal Center of Shanghai of China. Mice were divided into 6 groups and raised in the animal facilities of the Experimental Animal Center, Medical School, Southeast University, Nanjing, China, under sterile conditions in air-filtered containers. All the experiments were performed in compliance with the guidelines of the Animal Research Ethics Board of Southeast University, China. A2780 cell line was of ovarian cancer patients' origin, a well-established ovarian cancer model system, purchased from the Cellular Institute in Shanghai, China. The cells were utilized to generate a stable transfection using β-catenin shRNA, and were cultured at 37 °C in 5% CO 2 in air in complete media consisting of RPMI 1640, 2 mM L-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, and 10% fetal bovine serum.

Short hairpin RNA sequences of human MDR1 were designed according to MDR1 DNA sequence (GenBank NO.NM_000927) by the siDESIGN design software of Dharmacon Company (http://www.dharmacon.com/DesignCenter) and BLAST (http://www.ncbi.nlm.nih.gov/BLAST). Three target sequence sites for MDR1 shRNA were 959bp-978bp, 576bp-595bp and 2111bp-2130bp in MDR1 cDNA sequence, respectively. In addition, one scrumbe sequence was designed as negative control. [12],[13] Eight shRNA sequences are as follows:

MDR1-siRNA1:sense

CCCCTGCGACAGGAGATAGGCTGTTCAAGAGACAGCCTATCTCCT GTCGCATTTTTGGAAA-3?; antisense, 5?- AGCTTTTCCAAAAATGCGACAGG AGAT AGGCTG-TCTCTTGAA-CAGCCTATCTCCTGTCGCA-GGG-3?; MDR2 -siRNA 2: sense, 5?-G ATCCCCGGAAAAGAAACCAACTGTCTTCAAGAGAC CTTTTCTTTGGTTGACAGTTTTTGGAAA-3;antisense, 5?-AGCTTTTCCAAAA AGGAAAAGAAACCAACTGTCTCTCTTGAA CCTTTTCTTTGGTTGACAG -G GG-3?; MDR3-siRNA3: sense, 5?- GATCCCCGCGAAGCAGTGGTTCAGGTTT CAAGAGAACCTGAACCACTGCTTCGCTTTTTGGAAA-3; antisense,5?-A GCGAAGCAGTGGTTCAGGTTCTCTTGAAACCTGAACCACTGCTTC GCGGG-3?; Scrambled sequence sense, 5'-GATCCCCTTCTCC G AACGTGTCACGTTTCAA GAGAACGTGACACGTTCGGAGAATTTTTGGAA A-3'; antisense, 5'-AGCTTTTCCAAAAATTCTCCGAACGTGTCACGTTCTCT TGAAACGTGACACGTTCGGAGAAGGG-3'. All the primers were synthesized by Company of Gene and Technology of China in Shanghai.

A pSUPER-EGFP1 (enhancement green fluorescent protein 1) vector was used to construct recombinants. The recombinants pSUPER-EGFP1-MDR1-shRNAs (MDR1-shRNA1, MDR1- shRNA2 and MDR1-shRNA3) were developed according to previous reports. [13],[14],[15] A pSUPER- EGFP1-scrambled shRNA was used as a negative control. These recombinants were identified by the analysis of an endonuclease digestion.

To select the stable cell clones of Pgp production, we transfected with the different pSUPER-EGFP1- MDR1-shRNA constructs into the A 2780 cells by using Lipofectamine TM 2000 reagent (Invitrogen, USA) according to the manufacturer's protocol. Following antibiotic selection with 800 mg/ml G418 (Clontech, CA), several pSUPER-EGFP1-MDR1-shRNA-expressing clones were isolated and expanded into cell lines. Three clones transfected with pSUPER-EGFP1- MDR1-shRNA-expressing vectors and one clone transfected with pSUPER-EGFP1-scrambled shRNA- expressing vector were selected and then screened for Pgp expression by fluorescence microscope, quantitative reverse transcriptase-PCR (qRT-PCR) and Western blotting, respectively. [2],[15] We named three clones stably transfected with pSUPER-EGFP1-MDR1-shRNA- expressing vectors for the MDR1-shRNA1 cells, MDR1-shRNA 2 cells and MDR1-shRNA3 cells down regulated Pgp expression, respectively. We also named the clone stably transfected with pSUPER- EGFP1-scrambled shRNA-expressing vector for the scrambled shRNA cells expressing Pgp no change, and the clone stably transfected with pSUPER-EGFP1 vector for the pSUPER-EGFP1 cells not expressing Pgp.

qRT-PCR analysis was performed on a Step One Plus real-time system (AB Applied Biosystems). β-actin was used as an internal control. RNA was isolated from each sample by using a Qiagen RNeasy Kit (Qiagen, Valencia, CA). An additional DNase I digestion procedure (Qiagen, Hilden, Germany) was included in the isolation of RNA to remove contaminating DNA and performed according to the manufacturer's protocol. One microgram of total RNA from each sample was subject to cDNA synthesis using Superscript III reverse transcriptase and random hexamer (invitrogen). Then the cDNA was amplified by PCR with primers specific for MDR1 (sense, 5?-CGAATGTCTGAGGACAAGCCAC-3?; antisense, 5?- CC ATG AGGTCCTGGGCATG-3?) and the β-actin gene (sense, 5?-GGACTTCGAGCAAG AGATGG-3?; antisense, 5?-AGCACTGTGT TGGCGTACAG-3?), using a PCR Master Mix Reagents Kit (AB Applied Biosystems). Relative gene expression was determined based on the threshold cycles of the genes of interest and the internal control gene. The mRNA levels of the genes of interest are expressed as the ratio of each gene of interest to β-actin mRNA for each sample. [13],[16]

1×10 6 A2780 cells that were stablely transfected with the pSUPER-EGFP1-MDR1-shRNAs or the pSUPER-EGFP1-scrambled shRNA were collected and lyzed in protein extraction buffer (Novagen, USA) according to the manufacturer's protocol. 10% sodium dodecyl sulfate- polyacrylamide gel electrophoresis and proteins (15μg/lane) were electrotransferred onto a nitrocellulose membrane that was first blocked with 4% dry milk in tris-buffered saline with Tween-20 for 1 h at 20 °C and then incubated with the mouse antibody specific to human Pgp (BD company, USA) for 1.5 h at 20 °C. The membrane was rinsed for 5 min with antibody wash solution 3 times before adding goat anti-mouse secondary antibody conjugated to horseradish peroxidase for 1 h at 20 °C. Immunoreactive bands were detected by the enhanced chemiluminescence reaction (Amersham). [12],[15]

1×10 4 A2780 cells that were stably transfected with the pSUPER-EGFP1-MDR1- shRNAs, the pSUPER-EGFP1 vector or with the pSUPER-EGFP1-scrambled shRNA were seeded into a 96-well plate with 0.5 μg/ml vincristine or 0.3μg /ml paclitaxel or 0.2μg/ml docetaxel in each well for 54 h, respectively. Three drugs were all ordered from the Lukang Drug Corporation, Shandong, China. Cellular resistance to chemotherapeutic agents were detected by a 3-(4,5- dimethylthiaxol- 2-yl)-2,5-diphenyltetra-zolium bromide (MTT) assay. For colorimetric analysis, the absorbance at 490 nm was recorded using a microplate reader. Each experiment was repeated at least 3 times. [17],[18]

The colony formation ability of A2780 cells transfected with the pSUPER-EGFP1-MDR1- shRNAs, the pSUPER-EGFP1 vector or the scrambled control siRNA in the plating were respectively assayed. Colony diameters larger than 75μm or colony cells more than 50 cells were then counted as 1 positive colony according to our previous reports. [1],[19],[20]

Tumor formation and treatment of tumor-bearing mice were carried out in 6 groups of Balb/c nude mice (A2780 cell group, A2780-pSUPER-EGFP1 group, A2780- scrambled shRNA, A2780-MDR1- shRNA1group, A2780-MDR1- shRNA2 group and A2780-MDR1-shRNA3 group). 5×10 6 A2780 cells transfected with the pSUPER-EGFP1-MDR1-shRNAs or the scrambled control siRNA or the mock plasmids were respectively injected subcutaneously into mice. Tumor formations in these animals were monitored weekly by 2-dimensional measurements of individual tumors from each animal. [12],[15] The ovarian cancer-bearing nude mice were intraperitoneally injected with paclitaxel (10mg/kg) for successive two weeks, once each week. 4 mice from each of the six treated groups were sacrificed for detecting the tumor sizes as evaluation of paclitaxel efficacy two weeks after the therapy.

Values were presented as the mean plus or minus standard deviation. Statistical comparisons were performed using the Student's t-test method and P<0.05 was considered as statistically significant.


 > Results Top


The expression of MDR1 in A2780 ovarian cancer cells was identified by RT-PCR (data not shown). These cells stably transfected with the different pSUPER-EGFP1-MDR1-shRNA constructs were successfully selected after antibiotic selection with 800 mg/ml G418 for 12 days. The clones transfected with pSUPER-EGFP1-MDR1-shRNA1, pSUPER-EGFP1-MDR1-shRNA2, pSUPER-GFP1-MDR1-shRNA3 expressing vectors and the clones transfected with pSUPER- EGFP1 plasmids or pSUPER-GFP1-scrambled shRNA expressing vector were respectively isolated through single-clone isolation assay and expanded into cell lines. These clones expressing EGFP1-MDR1 were visible by fluorescence microscope, as shown in [Figure 1] A1-E2, respectively. It was also shown that the MDR1 mRNA expression [Figure 1]b and the Pgp protein expression [Figure 1]c were markedly decreased in the transfectant A2780 cells, especially in the MDR1 mRNA expression in the MDR1-shRNA1 cells and the MDR1-shRNA2 cells as well as the Pgp protein expression in MDR1-shRNA2 cells, but not in the EGFP1-shRNA cells and the scrambled shRNA cells. The data indicated that our constructed recombinants containing MDR1-shRNAs were developed appropriately, which conduces to further study of the effects of Pgp downregulation on MDR of A2780 ovarian cancer cells.
Figure 1: Stably transfected MDR1-shRNAs cell clones and expressions of MDR1 and Pgy. Photos of top-panel observed under a fluorescent microscope (A-E) and bottom-panel observed under a light microscope (A1-E1) show the A2780 ovarian cancer cells stably transfected with the different constructs. A-A1: A2780 pSUPER-EGFP1 cells; B-B1: A2780 scrambled-shRNA cells; C-C1: A2780 MDR1- shRNA 1 cells; D-D1: A2780 MDR1-shRNA 2 cells. E-E1: A2780 MDR1-
shRNA3 cells. Fig.1F represents the results of quantitative reverse transcriptase-PCR in the different stable transfectants and the changes in the expression of target gene MDR1 after downregulation of MDR1 in ovarian cancer cell lines. Significant difference is indicated by asterisk (***) for P < 0.001, which represents the A2780 mDR1-shRNA 2 cells compared with the A2780 cells or the A2780 pSUPER-EGFP1 cells or the A2780 scrambled shRNA cells, respectively. Fig.1G indicates the results of western blotting for detection of Pgy expression in the different transfected A2780 cells.


Click here to view


Cellular chemosensitivity to drugs in vitro were measured with the A2780 cells transfected with the pSUPER-EGFP1-MDR1-shRNAs or the scrambled control siRNA. [Figure 2]a and d give the inhibitive rates when the different transfected A2780 cells were incubated with the vincristine (4×10 -3μg/ml) or paclitaxel (5×10 -3μg/ml) or docetaxel (4.5×10 -4μg/ml) or cisplatin (3×10 -3μg/ml) for 54 h. In [Figure 2]a, it was found that the inhibitive rate of the vincristine to MDR1-shRNA2 cell proliferation was significantly higher than that of the A2780 scrambled shRNA cells or the A2780 pSUPER-EGFP1 cells (47.0±4.26% compared with 19.09±2.58% or 9±1.24%, P<0.01). The association of MDR1 downregulation with chemosensitivity to the vincristine, the inhibitive rates of paclitaxel and docetaxel to MDR1-shRNA2 cell proliferation indicated the similar results (46.04±4.30% compared with 13.68±7.78% or 16±3.14%, P<0.01) and (38.84±4.49% compared with 15.89±4.72% or 19±9.69%, P<0.05) in order as are shown in [Figure 2]b and c. However, the inhibitive rate of the cisplatin to MDR1-shRNA2 cell proliferation was not significantly higher than that of the A2780 scrambled shRNA cells or the A2780 pSUPER-EGFP1 cells (22±6.59% compared with 17±4.15% or 18±3.78%, p>0.05) as is shown in [Figure 2]d. In [Figure 2], it was also found that the inhibitive rates of the above-mentioned drugs to the A2780 MDR1-shRNA1 cells or the A2780 MDR1-shRNA3 cells were not significant increased compared with the A2780 pSUPER-EGFP1 cells and the A2780 scrambled shRNA cells.
Figure 2: Cellular chemoresistance to drugs. A cellular chemosensitivities to drugs vincristine (a), paclitaxel (b), docetaxel (c) and cisplatin (d) were performed in triple wells after these drugs were respectively incubated with the transfected A2780 cells for 54 h. Relative cell inhibitive rates were detected by a MTT assay. Each condition was repeated at least 3 times. Significant difference is indicated by asterisk (**) for P < 0.01, which represents the A2780 MDR1-shRNA 2 cells
compared with the other cells, respectively.


Click here to view


In the present study, we evaluated the effect of knockdown of MDR1 in A2780 cells on the colony formation capability in vitro. The MDR1-shRNAs and the scrambled shRNA were transfected into the A2780 cells, respectively and the colony formation assay was performed with the stable expression clones. As shown in [Figure 3], the colony formative rates were no significant differences between the A2780 pSUPER-EGFP1-MDR1-shRNAs cells and the other control A2780 cells although the rates of the A2780 pSUPER-EGFP1-MDR1-shRNAs were a little lower than that of the A2780 cells (p>0.05). The results suggested that the knockdown of MDR1 in A2780 cells have no influences on the colony formation capability in the MDR1-shRNAs transfected A2780 cells.
Figure 3: Analysis of colony formative ability in the transfected A2780 cells in vitro. (A-F) represent colony formative ability of A2780 cells, A2780 pSUPER-EGFP1 cells, A2780 scrambled-shRNA cells, A2780 MDR1-shRNA 1 cells, A2780 MDR1-shRNA 2 cells and A2780 MDR1- shRNA3 cells in order. (G) exhibits the colony formative rates of the different cells. The results suggested that the colony formative rates were no signifi cant differences between the knockdown of MDR1 A2780 cells and the A2780 cells or the A2780 pSUPER-EGFP1 cells or the A2780 scrambled-shRNA cells

Click here to view


The effect of knockdown of MDR1 in A2780 cells on tumorigenicity was investigated in Balb/c nude mice. [Figure 4]a-f show that 4 out of 4 mice developed tumors in 17 days after implantation of 5×10 6 the A2780 pSUPER-EGFP1-MDR1-shRNAs cells and the other control A2780 cells. The tumor sizes as per evaluation of the therapeutic efficacies of antiovarian drugs suggested that the transfectant MDR1-shRNA2 cells enhanced chemosensitivity to paclitaxel in vivo. This is because that the mean tumor size was only 69±9.97mm 2 that was obviously decreased compared with the A2780 cells (144±15.22mm 2 , P<0.01) or the A2780 pSUPER-EGFP1 cells (107±13.76mm 2 , P<0.01) and the A2780 scrambled shRNA cells (144±19.27mm 2 , P<0.01) two weeks after paclitaxel therapy. But neither the MDR1-shRNA1 cells nor the MDR1-shRNA3 cells decreased as the chemoresistance to paclitaxel as the MDR1- shRNA2 cells did because the mean of tumor size had no marked difference between the mice inoculated with the A2780 MDR1-shRNA1 cells (139±16.17mm 2 , p> 0.05) or the A2780 MDR1-shRNA3 cells (116±14.24mm 2 , p> 0.05) compared with the control groups.
Figure 4: Efficacy of knockdown of MDR1 in A2780 cells on its tumorigenicity and the sensitivity of chemotherapeutic agent paclitaxel in the tumor bearing nude mice. 5×106 no transfected A2780 cells and the A2780 cells stably transfected with the scrambled shRNA construct or the mock plasmids or the different MDR1-shRNA constructs were
injected into flank of nude mice, respectively. (A to F) represent the A2780 cell group, the A2780 pSUPER-EGFP1 cells group, the A2780 scrambled shRNA cells group, the MDR1-shRNA1 cell group, the MDR1-shRNA2 cell group and the MDR1-shRNA3 cell group in order. Photos were pictured at 17 days after the different cells were injected into the mice and the formed tumors were pointed by arrows. (G) shows the tumor sizes after the tumor bearing nude mice were treated with paclitaxel. Signifi cant difference is indicated by asterisk (**) for P < 0.01, which represents the A2780 mDR1-shRNA 2 cells compared with the other cells, respectively


Click here to view



 > Discussion Top


MDR of cancer cells continues to be a major impediment to a successful chemotherapy in ovarian cancer patients. [21],[22] In this study, we have selected the human ovarian cancer cell line A2780 as our study target cells to explore the effects of MDR1 downregulation on reverse MDR of ovarian cancer cells and to find a new treatment target for ovarian caner therapy.

Our results demonstrated that the three transfectant MDR1-shRNAs targeting human Pgp encoding gene MDR1 and one transfectant scrambled shRNA were respectively developed in accordance with the MDR1 DNA sequence and the characteristic of pSUPER-EGFP1 plasmid. Further, we transfected the constructed four recombinant plasmids and pSUPER-EGFP1 mock plasmid into the A2780 ovarian cancer cells, respectively and the stably transfected cells were selected according to the characteristic of resistance to G418 and expression of EGFP1, as are shown in [Figure 1] A1-F2. As revealed by qRT-PCR and Western blotting, the recombinant shRNA2 plasmid targeting human MDR1 obviously down regulated the expressive levels of MDR1 mRNA and Pgp protein. To address the functional significance of the downregulation of MDR1 gene expression, we first evaluated the sensitivity of chemotherapeutic agents, such as vincristine, paclitaxel, docetaxel and cisplatin, in the transfected A2780 MDR1-shRNAs cells, respectively in vitro. The downregulation of Pgp protein expression in the stably transfected MDR1-shRNAs cells caused the raise of chemosensitivity to vincristine, paclitaxel and docetaxel, which markedly reflected in the increase of the inhibiting the MDR1-shRNA2 cell proliferation [Figure 2]a-c. However, the downregulation of Pgp appeared to be no elevation of chemosensitivity to the platinum complexes cisplatin in the MDR1-shRNAs cells compared with the control cells [Figure 2]d. With these results, we think that the ovarian cancer cells are usually initially sensitive to cisplatin and the biochemical mechanism of the development of chemoresistance may lead to the increased levels of cellular glutathione (GSH) and glutathione S-transferases that are important in the detoxification of alkylating agents and cisplatin. Clinical trials have already showed that the use of alkylating agents combined with inhibition of GSH biosynthesis or enzymatic inhibitors of glutathione S-transferase activity could increase the therapeutic efficacy of anticancer drug cisplatin. [23],[24] In our current study, the downregulation of MDR1 gene expression may influence the role of drug transporter, an energy-dependent efflux pump that functions in the extrusion of drugs from the cells, such as vincristine, paclitaxel and docetaxel.The GSH and glutathione S-transferases, however, was not been affected due to downregulation of MDR1 expression. Therefore, it was not found that the elevation of the sensitivity of chemotherapeutic agent cisplatin in the transfected A2780 MDR1-shRNAs cells is in contrast to the mock plasmids or scrambled shRNA cells.

To further confirm the effects of downregulated MDR1 in the A2780 ovarian cancer cells in vivowe evaluated the therapeutic efficacy of chemotherapeutic agent paclitaxel on ovarian cancer in xenografts mice bearing A2780 ovarian cancer model. The mice inoculated with the transfected A2780 MDR1-shRNAs cells and the mock plasmids or scrambled shRNA cells all generated tumors in 17 days [Figure 4]A-F. These results hinted the downregulation of MDR1 expression did not affect the oncogenicity of A2780 MDR1-shRNAs cells that were in accordance with the results of the capability of clonogenicity in the plating in vitro. Because the knockdown of MDR1 in the MDR1-shRNAs transfected A2780 cells did not affected their colony capability [Figure 3], the oncogenicity of MDR1-shRNAs transfected A2780 cells in xenografts mice, theoretically, may be similar to no transfected A2780 cells. Since the studies on the biological characteristic of tumor cells have demonstrated that the clonal capability in vitro was used to measure the capability of tumor cells to cross tissue barriers and cell invasion, and that the clonal efficiency correlated positively with the disease stage of carcinoma. [16],[19],[25] Significantly, the therapeutic efficacy of antiovarian drug paclitaxel in vivo was apparently enhanced in the MDR1-shRNA2 transfected A2780 cells, but not in the MDR1-shRNA1 transfected A2780 cells or the MDR1-shRNA3 transfected A2780 cells. This was supported by the tumor sizes after the tumor bearing nude mice was injected with paclitaxel [Figure 4]G.


 > Conclusions Top


The data presented in this paper clearly demonstrated that the knockdown of MDR1 expression resulted in decreasing the expression of Pgy, and that the downregulation of Pgy is associated with the increase of sensitivity of chemotherapeutic agents vincristine, paclitaxel and docetaxel in vitro, and also the increase of the therapeutic efficacy of paclitaxel in the nude mice inoculated with the transfected A2780 MDR1-shRNA2 cells. This emphasizes that the MDR1 is essential for MDR in ovarian cancer A2780 cell line and may be a target for ovarian cancer therapy although the molecule mechanism of MDR1 remains to be further validated.


 > Acknowledgements Top


We thank Ms. Cuilian Jiang for technical assistance in developing the vector constructs. This work was supported in part by the National Natural Science Foundation of China (No. 81071769), and in part by the Groundbreaking experimental design of undergraduate student in China (No. G2007059), and in part by the 973 Program of China (No.2011CB933500).

 
 > References Top

1.Jun D, Cuilian J, Jing W, Xiang Z, Fengsu Z, Weiha H, et al. Using ABCG2-Molecule-Expressing Side Population Cells to Identify Cancer Stem-Like Cells in a Human Ovarian Cell Line. Cell Biol Int 2011;35:227-234.  Back to cited text no. 1
    
2.Burkhalter RJ, Symowicz J, Hudson LG, Gottardi CJ, Stack MS. Integrin Regulation of {beta}-Catenin Signaling in Ovarian Carcinoma. J Biol Chem 2011;286:23467-75.  Back to cited text no. 2
[PUBMED]    
3.Chou ST, Rabkin BA, Dowling S, Vaezy S, Theiss P. Immunocompetent orthotopic isograft mouse model of ovarian cancer for high-intensity focused ultrasound (HIFU) treatment. Comp Med 2004;54:645-651.  Back to cited text no. 3
[PUBMED]    
4.Ferrandina G, Martinelli E, Petrillo M, Prisco MG, Zannoni G, Sioletic S, et al. CD133 antigen expression in ovarian cancer. BMC Cancer 2009;9:221-9.  Back to cited text no. 4
[PUBMED]    
5.Yokota K, Hirano T, Urata N, Yamauchi N, Hattori MA. Upregulation of p-glycoprotein activity in porcine oocytes and granulosa cells during in vitro maturation. J Reprod Dev 2011;57:322-6.  Back to cited text no. 5
[PUBMED]    
6.He SM, Li R, Kanwar JR, Zhou SF. Structural and functional properties of human multidrug resistance protein 1 (MRP1/ABCC1). Curr Med Chem 2011;18:439-81.  Back to cited text no. 6
[PUBMED]    
7.Chen H, Hao J, Wang L, Li Y. Coexpression of invasive markers (uPA, CD44) and multiple drug-resistance proteins (MDR1, MRP2) is correlated with epithelial ovarian cancer progression. Br J Cancer 2009;101:432-40.  Back to cited text no. 7
    
8.van Waterschoot RA, Lagas JS, Wagenaar E, Rosing H, Beijnen JH, Schinkel AH. Individual and combined roles of CYP3A, P-glycoprotein (MDR1/ABCB1) and MRP2 (ABCC2) in the pharmacokinetics of docetaxel. Int J Cancer 2010;127:2959-64.  Back to cited text no. 8
[PUBMED]    
9.Ling PS, Lau MT, Hammond GL, Leung PC. Gonadotropin-releasing hormone-II increases membrane type I metalloproteinase production via beta-catenin signaling in ovarian cancer cells. Endocrinology 2011;152:764-72.  Back to cited text no. 9
    
10.Hakkarainen T, Hemminki A, Pereboev AV, Barker SD, Asiedu CK, Strong TV, et al. CD40 is expressed on ovarian cancer cells and can be utilized for targeting adenoviruses. Clin Cancer Res 2003;9:619-24.   Back to cited text no. 10
[PUBMED]    
11.Li Z, Hu S, Wang J, Cai J, Xiao L, Yu L, et al. MiR-27a modulates MDR1/P-glycoprotein expression by targeting HIPK2 in human ovarian cancer cells. Gynecol Oncol 2010;119:125-30.  Back to cited text no. 11
[PUBMED]    
12.Alper OD, Santis ML, Stromberg K, Hacker NF, Cho-Chung YS, Salomon DS. Anti-sense suppression of epidermal growth factor receptor expression alters cellular proliferation, cell-adhesion and tumorigenicity in ovarian cancer cells. Int J Cancer 2000;88:566-74.  Back to cited text no. 12
    
13.Su HY, Lai HC, Lin YW, Liu CY, Chen CK, Chou YC, et al. Epigenetic silencing of SFRP5 is related to malignant phenotype and chemoresistance of ovarian cancer through Wnt signaling pathway. Int J Cancer 2010;127:555-67.  Back to cited text no. 13
[PUBMED]    
14.Zhao F, Jun D, He X, Wang J, Chu L, Hu W, et al. Enhancing therapy of melanoma efficacy via tumor cell vaccine expressing GPI-anchored IL-21 and secreting GM-CSF in mouse model. Vaccine 2010;28:2846-52.   Back to cited text no. 14
    
15.Hu W, Wang J, Dou J, He X, Zhao F, Jiang C, et al. Augmenting Therapy of Ovarian Cancer Efficacy by Secreting IL-21 Human Umbilical Cord Blood Stem Cells in Nude Mice. Cell Transplant 2011;20:669-80.  Back to cited text no. 15
    
16.Ouyang L, Shen LY, Li T, Liu J. Inhibition effect of Oncostatin M on metastatic human lung cancer cells 95D in vitro and on murine melanoma cells B16BL6 in vivo. Biomed Res 2006;27:197-202.  Back to cited text no. 16
    
17.Dou J, Tang Q, Zhao F, Chu L, Chen J, Cao M, et al. Comparison of immune responses induced in mice by vaccination with DNA vaccine constructs expressing Mycobacterial antigen 85A and Interleukin-21 and Bacillus Galmette- Guérin. Immunol Invest 2008;37:113-27.  Back to cited text no. 17
[PUBMED]    
18.Mosmann TR. Colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J Immunol Methods 1983;65:55-63.  Back to cited text no. 18
    
19.Dou J, Li Y, Zhao F, Hu W, Wen P, Tang Q, et al. Identification of tumor stem-like cells in a mouse myeloma cell line. Cell Mol Biol (Noisy-le-grand) 2009;55 Suppl:OL1151-60.  Back to cited text no. 19
    
20.Jun D, Meng P, Wen P, Li T, Tang Q, Chu L, et al. Isolation and Identification of Cancer Stem Like Cells from Murine Melanoma Cell Lines. Cell Mol Immunol 2007;4:467-72.  Back to cited text no. 20
    
21.Patwardhan G, Gupta V, Huang J, Gu X, Liu YY. Direct assessment of P-glycoprotein efflux to determine tumor response to chemotherapy. Biochem Pharmacol 2010;80:72-9.  Back to cited text no. 21
    
22.Yoshida N, Takada T, Yamamura Y, Adachi I, Suzuki H, Kawakami J. Inhibitory effects of terpenoids on multidrug resistance-associated protein 2- and breast cancer resistance protein-mediated transport. Drug Metab Dispos 2008;36:1206-11.   Back to cited text no. 22
    
23.Solár P, Sykowski AJ. Differentially expressed genes associated with cisplatin resistance in human ovarian adenocarcinoma cell line A2780. Cancer Lett 2011;309:11-8.   Back to cited text no. 23
    
24.Johnson SW, Ozols RF, Hamilton TC. Mechanisms of drug resistance in ovarian cancer. Cancer 1993;71:44-9.  Back to cited text no. 24
    
25.Matsui W, Huff CA, Wang Q, Malehorn MT, Barber J, Tanhehco Y, et al. Characterization of clonogenic multiple myeloma cells. Blood 2004;103:2332-6.  Back to cited text no. 25
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]



 

Top
Print this article  Email this article
  

    

Contact us | Sitemap | Advertise with us | What's New | Copyright and Disclaimer
© 2005 Journal of Cancer Research and Therapeutics
Published by Medknow
Online since 1st April '05